- Methodology
- Open Access
A community resource for high-throughput quantitative RT-PCR analysis of transcription factor gene expression in Medicago truncatula
https://doi.org/10.1186/1746-4811-4-18
© Kakar et al; licensee BioMed Central Ltd. 2008
- Received: 15 April 2008
- Accepted: 08 July 2008
- Published: 08 July 2008
Abstract
Background
Medicago truncatula is a model legume species that is currently the focus of an international genome sequencing effort. Although several different oligonucleotide and cDNA arrays have been produced for genome-wide transcript analysis of this species, intrinsic limitations in the sensitivity of hybridization-based technologies mean that transcripts of genes expressed at low-levels cannot be measured accurately with these tools. Amongst such genes are many encoding transcription factors (TFs), which are arguably the most important class of regulatory proteins. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) is the most sensitive method currently available for transcript quantification, and one that can be scaled up to analyze transcripts of thousands of genes in parallel. Thus, qRT-PCR is an ideal method to tackle the problem of TF transcript quantification in Medicago and other plants.
Results
We established a bioinformatics pipeline to identify putative TF genes in Medicago truncatula and to design gene-specific oligonucleotide primers for qRT-PCR analysis of TF transcripts. We validated the efficacy and gene-specificity of over 1000 TF primer pairs and utilized these to identify sets of organ-enhanced TF genes that may play important roles in organ development or differentiation in this species. This community resource will be developed further as more genome sequence becomes available, with the ultimate goal of producing validated, gene-specific primers for all Medicago TF genes.
Conclusion
High-throughput qRT-PCR using a 384-well plate format enables rapid, flexible, and sensitive quantification of all predicted Medicago transcription factor mRNAs. This resource has been utilized recently by several groups in Europe, Australia, and the USA, and we expect that it will become the 'gold-standard' for TF transcript profiling in Medicago truncatula.
Keywords
- Gene Expression Ratio
- Amplification Plot
- Invitrogen GmbH
- Gene PDF2
- Model Legume Species
Background
Legumes are second only to grasses in agricultural importance [1]. They are a mainstay of sustainable agricultural systems because of their ability to reduce atmospheric nitrogen (N2) to ammonia via a symbiosis with bacteria called rhizobia. This provides legumes and subsequent crops with a free and renewable source of nitrogen in lieu of expensive, environmentally-unfriendly fertilizers. Development and differentiation of root nodules, the organ that accommodates nitrogen-fixing rhizobia in legumes, is orchestrated by transcription factors [2–9]. Transcription factors are DNA-binding proteins that regulate the transcription of most, if not all genes [10]. As a result, TFs play central roles in all aspects of plant biology, including development and differentiation of organs and adaptive responses to changes in the environment [11]. Transcription factors as a whole are an important target of plant research because they are a key to understanding the regulation of important plant processes as well as potential tools to optimize these processes for agriculture.
The importance of TFs in plant biology is reflected by the fact that approximately 5% of all plant genes encode such proteins [10]. Thus, even species with relatively small genomes, such as Arabidopsis thaliana contain thousands of TF genes [10]. This presents a real challenge for systematic approaches to decipher the function of TF genes in plants. Classical, 'forward' genetics has uncovered the roles of perhaps a hundred TF genes in Arabidopsis [12] and far fewer in other species [11]. Reverse-genetic approaches, using T-DNA insertion mutants for instance [13], provide a means to decipher in a systematic and relatively rapid manner the function of TF genes/proteins, although gene-redundancy often stymies this enterprise [12]. Another stumbling-block is that phenotypes associated with non-redundant TFs may be subtle in nature.
Transcript profiling can help to uncover the functions of TF genes/proteins by revealing where and when in a plant TF genes are expressed. This information can help direct our attention to particular organs, developmental stages, or conditions under which aberrant phenotypes might become apparent in a TF mutant of interest.
Medicago truncatula is a model legume species that is currently the focus of an international genome sequencing effort [14]. Several generations of cDNA [15] and oligonucleotide arrays [16] have been developed for transcriptome analysis of Medicago truncatula, including most-recently an Affymetrix GeneChip that contains 51,000 probe-sets representing a large proportion of all the genes in this species [17]. While these tools now provide a means to measure the transcriptional output of a large proportion of genes in Medicago, inherent limitations in the sensitivity of hybridization-based technologies [18] mean that transcripts of a substantial number of genes cannot be detected even when probes for these transcripts are present on the array/chip. Furthermore, expansion of arrays to encompass novel genes uncovered by genome sequencing is not a trivial task. An alternative to arrays that is 2–3 orders of magnitude more sensitive and more flexible in terms of expansion to encompass novel genes is quantitative reverse transcription-polymerase chain reaction (qRT-PCR). Platforms for qRT-PCR analysis of thousands of Arabidopsis and rice TF genes have been developed by us and others [19, 20], and utilized to identify TF genes involved in Arabidopsis responses to nutrient stress and pathogen attack [21–24]. Here we describe a bioinformatics pipeline to identify putative TF genes in Medicago truncatula and to design gene-specific oligonucleotide primers for qRT-PCR analysis of all predicted TF transcripts. Over 1000 TF primer pairs were tested and used to identify sets of organ-enhanced TF genes that may play important roles in organ development or differentiation in this species.
Results and Discussion
Identification of putative transcription factors
Classification of putative transcription factors of Medicago into families and sub-families
TF Family | No. of Genes | Characteristic Domain (InterPro No.) | Domain Function | Domain Description |
---|---|---|---|---|
MYB/HD-like | 76 | IPR001005, IPR009057 | D | Myb, DNA-binding; homeodomain like |
MYB | 58 | IPR001005 | D | Myb, DNA-binding |
C2H2 (Zn) | 64 | IPR007087 | NA | Zn-finger, C2H2 type |
AP2/EREBP | 55 | IPR001471 | D | Pathogenesis-related transcriptional factor and ethylene response factor |
BHLH | 49 | IPR001092 | D | Basic helix-loop-helix dimerisation region bHLH |
HD-like | 50 | IPR009057 | D | Homeodomain like |
HD family | IPR001356 | D | Homeobox | |
HD | 25 | |||
HD-ZIP | 5 | IPR006712 | P | HD-ZIP protein, N terminus |
HD-PHD finger | 2 | IPR001965 | P | Zn-finger like, PHD-finger |
MADS | 48 | IPR002100 | D | TF, MADS-box |
BZIP | 41 | IPR004827 | D | Basic Leu zipper (bZIP) TF |
PHD | 34 | IPR001965 | P | Zn-finger like, PHD-finger |
WRKY family | IPR003657 | D | DNA-binding WRKY | |
WRKY | 29 | |||
LLR WRKY | 1 | IPR001611 | Leu-rich repeat | |
ABI3/VP1 | 29 | IPR003340 | D | TF B3 |
NAC | 29 | IPR003441 | D | No apical meristem (NAM) protein |
C3H-type1(Zn) | 27 | IPR000571 | D | Zn-finger, C-x8-C-x5-C-x3-H type |
ARF | 23 | IPR003340, IPR010525, IPR011525 | D | |
JUMONJI | 20 | IPR003347 | D | TF jumonji, jmjC |
GRAS | 19 | IPR005202 | P | GRAS TF |
HMG | 15 | IPR000637 | D | HMG-I and HMG-Y, DNA binding |
AS2 | 14 | IPR004883 | P | Lateral organ boundaries |
C2C2 (Zn) | ||||
Dof | 13 | IPR003851 | D | Zn-finger, Dof type |
GATA | 7 | IPR000679 | D | Zn-finger, GATA type |
CO-like | 6 | IPR000315 | D | Zn-finger, B-box |
YABBY | 5 | IPR006780 | D | YABBY protein |
CCAAT-HAP3 type | 12 | IPR003958 | D | TF CBF/NF-Y/archaeal histone |
GRF | 8 | IPR010666 | D | Zn-finger, GRF type |
SBP | 8 | IPR004333 | D | SBP |
EIL | 7 | IPR006957 | D | Ethylene insensitive 3 |
LIM | 7 | IPR001781 | P | Zn-binding protein, LIM |
SNF2 | 6 | IPR000330 | D | SNF2 family N-terminal domain |
E2F/DP | 5 | IPR003316 | D | TF E2F/dimerisation partner (TDP) |
TCP | 5 | IPR005333 | D | TCP TF |
FHA | 5 | IPR000253 | D | Forkhead-associated |
ARID | 4 | IPR001606 | D | AT-rich interaction region |
HSF | 4 | IPR000232 | D | Heat shock factor (HSF)-type, DNA binding |
AUX/IAA | 3 | IPR003311 | D | AUX/IAA protein |
SRS | 3 | IPR006510 | D | Zn-finger, LRP1 type |
TUB | 3 | IPR000007 | D | Tubby |
ZIM | 3 | IPR010399 | D | ZIM |
DDT | 3 | IPR004022 | D | DDT |
ZF-HD | 2 | IPR006455 | D | Homeobox domain, ZF-HD class |
MBF1 | 2 | IPR001387 | D | Helix-turn-helix type 3 |
S1Fa-like | 2 | IPR006779 | D | DNA binding protein S1FA |
CAMTA | 2 | IPR005559 | D | CG-1 |
LFY | 1 | IPR002910 | D | Floricaula/leafy protein |
Nin-like | 1 | IPR003035 | D | Plant regulator RWP-RK |
TAZ | 1 | IPR000197 | P | Zn-finger, TAZ-type |
Potentially novel plant TFs and transcriptional regulators | ||||
CCHC (Zn) | 112 | IPR001878 | NA | Zn-finger, CCHC-type |
RR | 16 | IPR001789, IPR011006 | RD | Response regulator receiver |
DHHC (Zn) | 14 | IPR001594 | D or P | Zn-finger, DHHC-type |
HTH | ||||
FIS | 11 | IPR002197 | D | Helix-turn-helix, Fis-type |
AraC | 2 | IPR000005 | D | Helix-turn-helix, AraC type |
BTB/POZ | 7 | IPR000210 | P | BTB |
TTF-type (Zn) | 6 | IPR006580 | D | Zn-finger, TTF-type |
BD | 6 | IPR001487 | P | Bromodomain |
Lambda-DB | 3 | IPR010982 | D | Lambda_DNA_bd |
TrpR | 3 | IPR010921 | D | Trp repressor/replication initiator |
TPR | 3 | IPR001440 | P | Tetratricopeptide TPR_1 |
KRAB-box | 2 | IPR001909 | P | KRAB box |
NRs | 2 | IPR008946 | LBD | Steroid nuclear receptor, ligand binding |
R3H | 2 | IPR001374 | NA | Single-stranded nucleic acid binding R3H |
YEATS | 2 | IPR005033 | TA | YEATS |
U1-type (Zn) | 2 | IPR003604 | NA | Zn-finger, U1-type |
A20-like | 2 | IPR002653 | P | Zn-finger, A20-type |
Euk_TF | 1 | IPR008917 | D | Euk_TF, DNA binding |
NGN | 1 | IPR006645 | D | NGN |
p53-like | 1 | IPR008967 | D | p53-like TF, DNA binding |
SSB protein | 1 | IPR011344 | D | Single-strand binding protein |
ssDB TR | 1 | IPR009044 | D | Single-strand DNA binding transcriptional regulator |
TCoAp15 | 1 | IPR003173 | D | Transcriptional coactivator p15 |
BED-type (Zn) | 1 | IPR003656 | D | Zn-finger, BED-type predicted |
TCoA | 1 | IPR009255 | TA | Transcriptional coactivation |
Tc/PD | 1 | IPR001533 | TA | Transcriptional coactivator |
PCR primer design
To ensure maximum specificity and efficiency during PCR amplification of TF cDNA under a standard set of reaction conditions, a stringent set of criteria was used for primer design. This included predicted melting temperatures (Tm) of 58°C to 61°C, limited self-complementarity and poly-X, and PCR amplicon lengths of 100–150 base pairs (bp). Secondary hits were minimized by aligning primer candidates to all known Medicago sequences via WU-BLAST [28] and eliminating primer pairs with multiple potential hits.
PCR primer testing: gene-specificity and amplification efficiency
PCR primers were tested on Medicago cDNA free of genomic DNA contamination as follows. First, total RNA was extracted from various organs using Trizol reagent (Invitrogen GmbH, Karlsruhe, Germany), which yielded high quality RNA as judged by gel electrophoresis and by Agilent 2100 BioAnalyser using RNA 6000 Nano Chips (Agilient Technologies, Waldbronn, Germany). Typical RNA yields ranged from 0.5–1.0 μg RNA/mg fresh mass for nodules and leaves, respectively. Isolated RNA was treated with DNAse I (Ambion, product number 1907) to remove all contaminating genomic DNA, and this was always confirmed by PCR using primers to non-coding regions of the Ubiquitin gene (TC102473; AC137828-19.4). After inactivation of DNAse I, RNA was reverse transcribed using SuperScript III reverse transcriptase (Invitrogen GmbH, Karlsruhe, Germany) and oligo-dT12–18 to prime the reaction.
Specificity of transcription factor PCR primers. Specificity was confirmed by dissociation curves with a single peak (A) while double peaks (B) indicated off-target ampification. The derivative of fluorescence intensity is shown on the y-axis. Separation of PCR products on 3% (v/w) agarose gels following electrophoresis (C) confirmed the presence of unique amplicons of the expected size for most reactions. Few reactions yielded no products (indicated by arrow).
Amplification efficiency of transcription factor-specific primer pairs. Typical real-time RT-PCR amplification plots of 384 TF genes (left) and distribution of PCR efficiencies for all 1045 TF primer pairs (right).
Selection of reference genes
Medicago reference genes and primers for qRT-PCR
Gene Name | TC | Accession Number | Forward/Reverse Primer (5'-3') | PCR Product Size (bp) | PCR efficiency (E) | R2 |
---|---|---|---|---|---|---|
β Tubulin | TC106341 | N | TTTGCTCCTCTTACATCCCGTG / GCAGCACACATCATGTTTTTGG | 100 | 1.08 | 1.00 |
PPRrep | TC96273 | N | GGAAAACTGGAGGATGCACGTA / ACAAGCCCTCGACACAAAACC | 100 | 0.93 | 1.00 |
PDF 2 | TC107161 | N | GTGTTTTGCTTCCGCCGTT / CCAAATCTTGCTCCCTCATCTG | 100 | 0.99 | 1.00 |
bHLH | CX538576 | N | TAGCGAGTACCATGATGCCAGA / GCGCCTCTTTTGTTTTCAGC | 100 | 0.89 | 1.00 |
UBC | AW686873 | N | CTGACAGCCCACTGAATTGTGA / TTTTGGCATTGCTGCAAGC | 100 | 0.96 | 1.00 |
PTB | TC111751 | N | CGCCTTGTCAGCATTGATGTC / TGAACCAGTGCCTGGAATCCT | 100 | 0.85 | 1.00 |
Ubiquitin | TC102473 | AC137828_19.4 | GCAGATAGACACGCTGGGA / AACTCTTGGGCAGGCAATAA | 100 | 0.95 | 1.00 |
UBC9 | TC106312 | AC137602_2.4 | GGTTGATTGCTCTTCTCTCCCC / AAGTGATTGCTCGTCCAACCC | 100 | 1.13 | 0.99 |
Helicase | CB892427 | N | GTACGAGGTCGGTGCTCTTGAA / GCAACCGAAAATTGCACCATAC | 100 | 0.91 | 1.00 |
ELF1α | EST317575 | N | GACAAGCGTGTGATCGAGAGATT / TTTCACGCTCAGCCTTAAGCT | 100 | 0.68 | 0.98 |
UPL7 | TC111218 | N | CCAGTTGTTCTCGTGGTCCATT / CCTCCAATTGTCGCCCAAA | 100 | 0.93 | 1.00 |
GAPDH | MtC00030_GC | CT573421_3.4 | TGCCTACCGTCGATGTTTCAGT / TTGCCCTCTGATTCCTCCTTG | 100 | 1.04 | 0.99 |
Actin2 | TC107326 | AC137836_27.5 | TCAATGTGCCTGCCATGTATGT / ACTCACACCGTCACCAGAATCC | 100 | 1.12 | 0.99 |
MSC27 | X63872 (M. sativa) | N | GTTGAAGTAGACATTGGTGCTAACG / AGCTGAGTCATCAACACCCTCAT | 100 | 0.76 | 0.99 |
Specificity, efficiency, and reproducibility of PCR primers designed to amplify reference gene transcripts. Specificity of primers was confirmed by the presence of unique amplicons of the expected size following electrophoresis on 3% (v/w) agarose gels (A) and by dissociation curves with a single peak (B to D). Typical real-time RT-PCR amplification plots of three reference gene transcripts (E to G).
Ranking of 8 reference genes in M. truncatula. Transcript levels of all 8 genes were measured by qRT-PCR, using 18 independent cDNA preparations from six different organs with three replicate measurements of each cDNA preparation. A low value for the average expression stability M, as calculated by geNORM software, indicates more stable expression throughout the various organs.
Identification of organ-enhanced TFs of Medicago
Organ-enhanced TF genes
A Root-enhanced TF genes identified by real-time RT-PCR | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Real-time RT-PCR Expression Ratio | Affymetrix Expression Ratio | ||||||||||
Accession Number | R/L | R/S | R/F | R/P | R/N | R/L | R/S | R/F | R/P | R/N | Affymetrix Chip ID |
AC140721_12.1 | 121.5 | 320.1 | 1623.4 | 2676.5 | 64.4 | 161.2b | 144.5b | 219.2b | 158.1b | 99.9 | Mtr.50075.1.S1_s_at |
AC135101_25.1 | 312.2 | 438.0 | 291.6 | 787.0 | 61.3 | n | n | n | n | n | n |
AC140721_14.1 | 1204.9 | 751.2 | 956.6 | 6296.6 | 32.6 | n | n | n | n | n | n |
AC140031_3.1 | 275.4 | 1157.3 | 923.4 | 258916.9a | 31.1 | 0.4 | 0.7 | 0.8 | 0.9 | 2.2 | Mtr.47227.1.S1_s_at |
AC140721_13.1 | 39.9a | 179.8 | 614.8 | 935.1a | 26.5 | 35.9 | 48.1b | 41.2 | 44.2b | 39.5 | Mtr.50074.1.S1_at |
AC140031_7.1 | 360.2a | 830.6 | 1542a | 6868.8 | 19.7 | 0.7b | 1b | 1.1b | 1b | 0.9b | Mtr.47229.1.S1_at |
AC146574_6.1 | 1095.7 | 11.9 a | 48.8 | 51.8 | 88.8 | 1.2b | 1.1b | 1.3b | 1.1b | 1.2b | Mtr.40781.1.S1_s_at |
AC125478_13.7 | 1117.4 | 7008.0 | 3264.9a | 7256.6 | 11.6 | 211.5b | 248.8b | 296.4b | 228.7b | 45.3 | Mtr.15416.1.S1_at |
AC125478_7.2 | 1052.3 | 503.3 | 938.4a | 2754.5 | 11.2 | n | n | n | n | n | n |
AC122726_21.111 | 50.0 | 48.0 | 20943.9 | 2658.6 | 10.4 | 74.3b | 76.4b | 72.8b | 82.8b | 26.6 | Mtr.15568.1.S1_s_at |
B Nodule-enhanced TF genes identified by real-time RT-PCR | |||||||||||
Real-time RT-PCR Expression Ratio | Affymetrix Expression Ratio | ||||||||||
Accession Number | N/L | N/S | N/F | N/P | N/R | N/L | N/S | N/F | N/P | N/R | Affymetrix Chip ID |
AC148816_3.2 | 9966.7 | 1826.2 | 6262.9 | 21709.1 | 662.7 | 434.6b | 516.8b | 455b | 521.7b | 551.4b | Mtr.14503.1.S1_at |
AC147774_3.2 | 55.2 a | 466.7 | 726.3 | 881.2 | 498.5 | 17.7b | 16b | 17.8b | 19.1b | 16.1b | Mtr.19554.1.S1_at |
AC138056_33.241 | 43.9 | 93.2 | 18.3 | 17.3 | 13.1 | 0.9b | 0.8b | 0.8b | 1.1b | 1.1b | Mtr.17993.1.S1_at |
AC124214_39.2 | 121.8 | 92.1 | 44.8 | 64.9 | 10.5 | n | n | n | n | n | n |
C Pod-enhanced TF genes identified by real-time RT-PCR | |||||||||||
Real-time RT-PCR Expression Ratio | Affymetrix Expression Ratio | ||||||||||
Accession Number | P/L | P/S | P/F | P/N | P/R | P/L | P/S | P/F | P/N | P/R | Affymetrix Chip ID |
AC143340_4.7 | 154.1 | 44.8 | 173.3 | 180.3a | 407.3 | 1.6b | 1.8b | 1.7b | 1.7b | 1.7b | Mtr.17931.1.S1_at |
D Flower-enhanced TF genes identified by real-time RT-PCR | |||||||||||
Real-time RT-PCR Expression Ratio | Affymetrix Expression Ratio | ||||||||||
Accession Number | F/L | F/S | F/P | F/N | F/R | F/L | F/S | F/P | F/N | F/R | Affymetrix Chip ID |
AC129092_13.1 | 40.3 | 383.3 | 65.1 | 1683.9 | 318.1 | 24.2 | 47.1b | 38.2 | 45.4b | 55.1b | Mtr.16432.1.S1_at |
AC148485_10.1 | 476.2 | 203.7 | 27.2 | 174.6 | 44.5 | 36.5b | 32.9b | 22.0 | 34.7b | 29.7b | Mtr.20392.1.S1_at |
AC140915_20.1 | 169.5 | 101.1 | 18.6 | 481.0 | 178.7 | 1.4b | 1.4b | 1.3b | 1.3b | 1.6b | Mtr.51688.1.S1_at |
AC141107_50.2 | 38.2 | 33.0 | 17.9 | 114.0 | 97.4 | n | n | n | n | n | n |
AC144731_15.21 | 64.4 | 44.3 | 33.6 | 61.5 | 16.3 | 0.6b | 0.6b | 0.8b | 0.8b | 0.8b | Mtr.19093.1.S1_at |
AC150978_12.1 | 235.3 | 198.5 | 48.4 | 14.0 | 16.9 | n | n | n | n | n | n |
AC141107.5.61 | 261.1 | 127.8 | 13.3 | 96.4 | 71.5 | 0.9b | 0.9b | 0.8b | 0.1b | 1.1b | Mtr.51651.1.S1_at |
AC157472_19.1 | 60.2a | 92.1 | 13.2 | 61.5a | 113.6 | n | n | n | n | n | n |
AC148527_19.141 | 188.4 | 42.1 | 17.3 | 26.5 | 13.0 | n | n | n | n | n | n |
AC144726_6.1 | 254.7 | 55.2 | 10.9 | 112.7a | 754.7 | 59.2 | 73.7b | 7.6 | 89.2 | 97.9b | Mtr.19024.1.S1_at |
AC157488_16.1 | 7053.2a | 141.1 | 18.7 | 81.8 | 10.7 | n | n | n | n | n | n |
AC123899_15.181 | 10.2 | 92.2 | 19.1 | 62.8 | 24.9 | 0.9b | 0.5b | 0.8b | 0.1b | 0.8b | Mtr.52015.1.S1_at |
Conclusion
We have established a flexible platform for high-throughput qRT-PCR analysis of Medicago TF gene expression that is based on gene-specific primers arrayed in 384-well plates and SYBR® Green detection of gene-specific PCR amplicons. Currently, the platform has primer pairs for 1045 TF genes and we have plans to extend this to all predicted Medicago TF genes as genome sequencing progresses. At this stage, the resource has been utilized by several groups in Europe, Australia, and the USA, and we expect it will become the 'gold-standard' for TF transcript profiling in Medicago truncatula.
Methods
Plant material and growth conditions
Medicago truncatula cv. Jemalong, line A17 wild type plants were vernalized for 3 days in the dark at 4°C on sterile, wet filter paper. Germinated seedlings were transferred to pots containing Turface (BWI Texarcana, Texarcana, TX). Plants were grown in growth chambers under a 16 h day and 8 h night regime, at 200 μE light intensity, 24°C and 40% relative humidity.
Vegetative organs (leaves, stems, roots, and nodules) were harvested 28 days after planting. Leaf material did not include petioles and stems did not include buds. Roots consisted of the entire root system with laterals. Several plants grown at the same time were pooled for each of the three biological replicates. Biological replicates were planted on separate days. Nodules were harvested from plants inoculated with Sinorhizobium meliloti strain 1021 one and seven days after sowing. Reproductive organs were harvested from plants that were vernalized for two weeks to decrease the time to flowering. Flowers were harvested on the day of opening. Pods were harvested from 1 to 21 days after the appearance of the floral bud to cover a wide range of developmental stages. Harvested plant material was frozen in liquid nitrogen before storage at -80°C.
RNA isolation and cDNA synthesis
Total RNA was extracted using Trizol reagent [36], following the manufacturer's instructions (Invitrogen GmbH, Karlsruhe, Germany). RNA was quantified using a Nanodrop Spectrophotometer ND-100 (NanoDrop Technologies, Wilington, DE). Sixty μg of total RNA were digested with RNase free DNase1 (Ambion Inc., Houston, TX), according to manufacturer's protocol. RNA integrity was checked using an Agilent 2100 BioAnalyser and RNA 6000 Nano Chips (Agilient Technologies, Waldbronn, Germany), and by electrophoresis on a 3% (v/w) agarose gel before and after DNase I treatment. The absence of contaminating genomic DNA after DNase I treatment was verified by PCR analysis, using primer pairs designed to amplify a 107 bp genomic fragment of the control gene, Ubiquitin (TC102473intronF, 5'-GTCCTCTAAGGTTTAATGAACCGG-3'; TC102473intronR, 5'-GAAAGACACAGCCAAGTTGCAC-3').
First-strand complementary DNA was synthesized by priming with oligo-dT12–18 (Qiagen, Hilden, Germany), using SuperScript III reverse transcriptase (Invitrogen GmbH, Karlsruhe, Germany) following the instructions of the provider. To assess cDNA synthesis efficiency, qPCR was used to amplify segments in the 5' and 3' regions of Ubiquitin cDNA approx. 1600 and 400 bp from the 3'-end, respectively (primers: TC102473_5'F, 5'-TTGGAGACGGATTCCATTGCT-3'; TC102473_5'R, 5'-GCCAATTCCTTCCCTTCGAA-3; TC102473_3'F, 5'-GGCCCTAGAACATTTCCTGTGG-3'; and TC102473_3'R, 5'-TTGGCAACCAAAATGTTCCC-3'). If ΔCt (Ct3'-Ct5') < 2, then cDNA synthesis efficiency was judged to be satisfactory, and the cDNA was considered suitable for qRT-PCR analysis.
PCR primer design
The primer design pipeline was implemented in object-oriented PERL modules supported by a MySQL relational database. Primers iterated through three phases before approval: design, specificity, and selection.
The design phase interrogated TF genes with a sliding window 250 bp across that stepped 50 bp along the entire target sequence, generating primer candidates at each window. Experimental conditions, as outlined in the Results section above, were enforced by the following MIT Primer3 parameters: PRIMER_MIN_TM 58, PRIMER_OPT_TM 60, PRIMER_MAX_TM 61, PRIMER_SELF_ANY 6, PRIMER_SELF_END 2, PRIMER_MAX_POLY_X 3, and PRIMER_PRODUCT_SIZE_RANGE '100–150' [37]. The specificity phase aligned primer candidates via WU-Blast to a database of all known Medicago sequences. The selection phase sorted primer candidates by the number of possible secondary hits, self-complementarity, and poly-X characteristics. Secondary hits were defined as specificity alignments that contained at least one of the terminal ends of the primer and achieved 80% or greater identity over the length of the primer. The sequences of each primer pair are given in Supplementary Material (see Additional file 1).
Real-time PCR conditions and analysis
PCR reactions were carried out in an ABI PRISM® 7900 HT Sequence Detection System (Applied Biosystems, Foster City, CA, USA). SYBR® Green was used to quantify dsDNA synthesis. Reactions (5 μl total volume) were performed in an optical 384-well plate containing 2.5 μl 2 × SYBR® Green Power Master Mix reagent (Applied Biosystems, Warringen, UK), 5 ng cDNA and 200 nM of each gene-specific primer. Primer pairs were aliquoted using a pipetting robot (Evolution P3 liquid handling system, Perkin Elmer, MA, USA) to minimize pipetting errors. cDNA was aliquoted as a master mix of cDNA and 2 × SYBR® Green reagent, using an electronic Eppendorf multipipette. Reaction plates were sealed with a transparent adhesive cover before proceeding (Applied Biosystems, Foster City, CA, USA). All templates were amplified using the following standard PCR protocol: 50°C for 2 min; 95°C for 10 min; 40 cycles of 95°C for 15 sec and 60°C for 1 min, and SYBR® Green fluorescence was measured continuously. Melting curves were generated after 40 cycles by heating the sample up to 95°C for 15 sec followed by cooling down to 60°C for 15 s and heating the samples to 95°C for 15 sec.
Data analysis was performed with the SDS 2.2.1 software (Applied Biosystems). To determine the threshold cycle value (CT) for each PCR reaction, the threshold (ΔRn) was set within the logarithmic amplification phase. All amplification plots were analyzed with an ΔRn of 0.2. PCR efficiency (E) was estimated using LinReg software with data obtained from the exponential phase of each individual amplification plot and the equation (1+E) = 10slope [31]. To compare data from different PCR runs and different cDNA samples, CT values were normalized against the geometric mean of four reference genes (Ubquitin, PPRep, PDF2, and PTB), whose transcript levels were most stable across the biological samples analyzed. The average of the geometric mean of these four genes for all 18 samples was CT 21.23 ± SD1.15. For normalization, the mean reference gene CT value was substracted from the CT value of the TF gene of interest, yielding a ΔCT value. The expression ratios for the identification of organ-enhanced genes were obtained using the following formula on all 30 organ combinations: , where ΔΔCT was calculated by ΔCTA minus ΔCTb, A and B are averages of three biological replicates of the two organs being compared, and E is the PCR efficiency. Dissociation curves were analysed using SDS 2.2.1 software (Applied Biosystems). RT-PCR products were resolved on 3% (w/v) agarose gels (LE Agarose, Biozym, Oldendorf, Germany) run at 4 V cm-1 in TAE Tris-Acetate-EDTA buffer, along with a 200-bp DNA-standard ladder (Promega GmbH). A subset of 178 RT-PCR products was sequenced at the JC Venter Institute (Rockville, MD, USA).
Declarations
Acknowledgements
This work was supported in part by the European Commission FP6 Framework Programme Grain Legume Integrated Project (FOOD-CT-2004-506223), the Max Planck Society, the National Research Initiative (NRI) Plant Genome Program of the USDA Cooperative State Research, Education and Extension Service (CSREES), and the Samuel Roberts Noble Foundation.
Authors’ Affiliations
References
- Graham PH, Vance CP: Legumes: importance and constraints to greater use. Plant Physiology. 2003, 131: 872-877. 10.1104/pp.017004.PubMed CentralView ArticlePubMedGoogle Scholar
- Schauser L, Roussis A, Stiller J, Stougaard J: A plant regulator controlling development of symbiotic root nodules. Nature. 1999, 402 (6758): 191-195. 10.1038/46058.View ArticlePubMedGoogle Scholar
- Frugier F, Poirier S, Satiat-Jeunemaitre B, Kondorosi A, Crespi M: A Kruppel-like zinc finger protein is involved in nitrogen-fixing root nodule organogenesis. Genes Dev. 2000, 14 (4): 475-482.PubMed CentralPubMedGoogle Scholar
- Nishimura R, Ohmori M, Fujita H, Kawaguchi M: A Lotus basic leucine zipper protein with a RING-finger motif negatively regulates the developmental program of nodulation. Proceedings of the National Academy of Sciences of the United States of America. 2002, 99 (23): 15206-15210. 10.1073/pnas.222302699.PubMed CentralView ArticlePubMedGoogle Scholar
- Gronlund M, Gustafsen C, Roussis A, Jensen D, Nielsen LP, Marcker KA, Jensen EO: The Lotus japonicus ndx gene family is involved in nodule function and maintenance. Plant Molecular Biology. 2003, 52 (2): 303-316. 10.1023/A:1023967214199.View ArticlePubMedGoogle Scholar
- Kaló P, Gleason C, Edwards A, Marsh J, Mitra RM, Hirsch S, Jakab J, Sims S, Long SR, Rogers J, Kiss GB, Downie JA, Oldroyd GED: Nodulation signaling in legumes requires NSP2, a member of the GRAS family of transcriptional regulators. Science. 2005, 308 (5729): 1786-1789. 10.1126/science.1110951.View ArticlePubMedGoogle Scholar
- Smit P, Raedts J, Portyanko V, Debelle F, Gough C, Bisseling T, Geurts R: NSP1 of the GRAS protein family is essential for rhizobial Nod factor-induced transcription. Science. 2005, 308 (5729): 1789-1791. 10.1126/science.1111025.View ArticlePubMedGoogle Scholar
- Combier JP, Frugier F, de Billy F, Boualem A, El-Yahyaoui F, Moreau S, Vernie T, Ott T, Gamas P, Crespi M, Niebel A: MtHAP2-1 is a key transcriptional regulator of symbiotic nodule development regulated by microRNA169 in Medicago truncatula. Genes & Development. 2006, 20 (22): 3084-3088. 10.1101/gad.402806.View ArticleGoogle Scholar
- Middleton PH, Jakab J, Penmetsa RV, Starker CG, Doll J, Kaló P, Prabhu R, Marsh JF, Mitra RM, Kereszt A, Dudas B, VandenBosch K, Long SR, Cook DR, Kiss GB, Oldroyd GE: An ERF transcription factor in Medicago truncatula that is essential for Nod factor signal transduction. Plant Cell. 2007, 19 (4): 1221-1234. 10.1105/tpc.106.048264.PubMed CentralView ArticlePubMedGoogle Scholar
- Riechmann JL, Heard J, Martin G, Reuber L, Jiang CZ, Keddie J, Adam L, Pineda O, Ratcliffe OJ, Samaha RR, Creelman R, Pilgrim M, Broun P, Zhang JZ, Ghandehari D, Sherman BK, Yu GL: Arabidopsis transcription factors: Genome-wide comparative analysis among eukaryotes. Science. 2000, 290 (5499): 2105-2110. 10.1126/science.290.5499.2105.View ArticlePubMedGoogle Scholar
- Udvardi MK, Kakar K, Wandrey M, Montanari O, Murray J, Andriankaja A, Zhang JY, Benedito V, Hofer JMI, Chueng F, Town CD: Legume Transcription Factors: Global Regulators of Plant Development and Response to the Environment. Plant Physiol. 2007, 144 (2): 538-549. 10.1104/pp.107.098061.PubMed CentralView ArticlePubMedGoogle Scholar
- Riechmann JL: Transcriptional Regulation: a Genomic Overview. The Arabidopsis Book. Edited by: Somerville CR, Meyerowitz EM. 2002, The American Society of Plant Biologists, RockvilleGoogle Scholar
- Alonso JM, Ecker JR: Moving forward in reverse: genetic technologies to enable genome-wide phenomic screens in Arabidopsis. Nat Rev Genet. 2006, 7 (7): 524-536. 10.1038/nrg1893.View ArticlePubMedGoogle Scholar
- Young ND, Cannon SB, Sato S, Kim D, Cook DR, Town CD, Roe BA, Tabata S: Sequencing the genespaces of Medicago truncatula and Lotus japonicus. Plant Physiol. 2005, 137 (4): 1174-1181. 10.1104/pp.104.057034.PubMed CentralView ArticlePubMedGoogle Scholar
- El-Yahyaoui F, Küster H, Amor BB, Hohnjec N, Pühler A, Becker A, Gouzy J, Vernié T, Gough C, Niebel A, Godiard L, Gamas P: Expression profiling in Medicago truncatula identifies more than 750 genes differentially expressed during nodulation, including many potential regulators of the symbiotic program. Plant Physiology. 2004, 136 (2): 3159-3176. 10.1104/pp.104.043612.PubMed CentralView ArticlePubMedGoogle Scholar
- Hohnjec N, Vieweg MF, Pühler A, Becker A, Küster H: Overlaps in the transcriptional profiles of Medicago truncatula roots inoculated with two different Glomus fungi provide insights into the genetic program activated during arbuscular mycorrhiza. Plant Physiol. 2005, 137 (4): 1283-1301. 10.1104/pp.104.056572.PubMed CentralView ArticlePubMedGoogle Scholar
- Holmes P, Goffard N, Weiller GF, Rolfe BG, Imin N: Transcriptional profiling of Medicago truncatula meristematic root cells. BMC Plant Biol. 2008, 8 (1): 21-10.1186/1471-2229-8-21.PubMed CentralView ArticlePubMedGoogle Scholar
- Horak CE, Snyder M: Global analysis of gene expression in yeast. Funct Integr Genomics. 2002, 2: 171– 180-View ArticlePubMedGoogle Scholar
- Czechowski T, Bari RP, Stitt M, Scheible WR, Udvardi MK: Real-time RT-PCR profiling of over 1400 Arabidopsis transcription factors: unprecedented sensitivity reveals novel root- and shoot-specific genes. Plant Journal. 2004, 38 (2): 366-379. 10.1111/j.1365-313X.2004.02051.x.View ArticlePubMedGoogle Scholar
- Caldana C, Scheible WR, Mueller-Roeber B, Ruzicic S: A quantitative RT-PCR platform for high-throughput expression profiling of 2500 rice transcription factors. Plant Methods. 2007, 3: 7-10.1186/1746-4811-3-7.PubMed CentralView ArticlePubMedGoogle Scholar
- Scheible WR, Morcuende R, Czechowski T, Fritz C, Osuna D, Palacios-Rojas N, Schindelasch D, Thimm O, Udvardi MK, Stitt M: Genome-wide reprogramming of primary and secondary metabolism, protein synthesis, cellular growth processes, and the regulatory infrastructure of Arabidopsis in response to nitrogen. Plant Physiology. 2004, 136 (1): 2483-2499. 10.1104/pp.104.047019.PubMed CentralView ArticlePubMedGoogle Scholar
- McGrath KC, Dombrecht B, Manners JM, Schenk PM, Edgar CI, Maclean DJ, Scheible WR, Udvardi MK, Kazan K: Repressor- and activator-type ethylene response factors functioning in jasmonate signaling and disease resistance identified via a genome-wide screen of Arabidopsis transcription factor gene expression. Plant Physiol. 2005, 139 (2): 949-959. 10.1104/pp.105.068544.PubMed CentralView ArticlePubMedGoogle Scholar
- Morcuende R, Bari R, Gibon Y, Zheng W, Pant BD, Bläsing O, Usadel B, Czechowski T, Udvardi MK, Stitt M, Scheible WR: Genome-wide reprogramming of metabolism and regulatory networks of Arabidopsis in response to phosphorus. Plant Cell Environ. 2007, 30 (1): 85-112. 10.1111/j.1365-3040.2006.01608.x.View ArticlePubMedGoogle Scholar
- Libault M, Wan J, Czechowski T, Udvardi M, Stacey G: Identification of 118 Arabidopsis transcription factor and 30 ubiquitin-ligase genes responding to chitin, a plant-defense elicitor. Mol Plant Microbe Interact. 2007, 20 (8): 900-911. 10.1094/MPMI-20-8-0900.View ArticlePubMedGoogle Scholar
- Guo A, He K, Liu D, Bai S, Gu X, Wei L, Luo J: DATF: a database of Arabidopsis transcription factors. Bioinformatics. 2005, 21 (10): 2568-2569. 10.1093/bioinformatics/bti334.View ArticlePubMedGoogle Scholar
- Iida K, Seki M, Sakurai T, Satou M, Akiyama K, Toyoda T, Konagaya A, Shinozaki K: RARTF: Database and tools for complete sets of Arabidopsis transcription factors. DNA Res. 2005, 12 (4): 247-256. 10.1093/dnares/dsi011.View ArticlePubMedGoogle Scholar
- InterPro: Database of protein families, domains and sites. [http://www.ebi.ac.uk/interpro/]
- WU-BLAST: Washington University BLAST Archives. [http://blast.wustl.edu]
- NCBI: The National Center for Biotechnology Information. [http://www.ncbi.nlm.nih.gov/blast]
- UniProt: The Universal Protein Resource. [http://www.uniprot.org/]
- Ramakers C, Ruijter JM, Deprez RH, Moorman AF: Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett. 2003, 339: 62-66. 10.1016/S0304-3940(02)01423-4.View ArticlePubMedGoogle Scholar
- Pay A, Heberle-Bors E, Hirt H: An alfalfa cDNA encodes a protein with homology to translationally controlled human tumor protein. Plant Molecular Biology. 1992, 19: 501-503. 10.1007/BF00023399.View ArticlePubMedGoogle Scholar
- Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible WR: Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiology. 2005, 139: 5-17. 10.1104/pp.105.063743.PubMed CentralView ArticlePubMedGoogle Scholar
- geNORM software . [http://medgen.ugent.be/%7Ejvdesomp/genorm]
- Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F: Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology. 2002, 3: research0034.0031-research0034.0011. 10.1186/gb-2002-3-7-research0034.View ArticleGoogle Scholar
- Chomczynski P, Mackey K: Modification of the TRI reagent procedure for isolation of RNA from polysaccharide- and proteoglycan-rich sources. Biotechniques. 1995, 19 (6): 942-945.PubMedGoogle Scholar
- Rozen S, Skaletsky H: Primer 3 on the WWW for general users and for biologist programmers. Bioinformatics Methods and Protocols: Methods in Molecular Biology. Edited by: Krawetz S, Misener S. 2000, Totowa, NJ , Humana Press, 365-386.Google Scholar
- Benedito VA, Torres-Jerez I, Murray JD, Andriankaja A, Allen S, Kakar K, Wandrey M, Verdier J, Zuber H, Ott T, Moreau S, Niebel A, Frickey T, Weiller G, He J, Dai X, Zhao PX, Tang Y, Udvard MK: A gene expression atlas of the model legume Medicago truncatula. Plant Journal. 2008, (in press):Google Scholar
Copyright
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.