Skip to main content


Table 2 Medicago reference genes and primers for qRT-PCR

From: A community resource for high-throughput quantitative RT-PCR analysis of transcription factor gene expression in Medicago truncatula

Gene Name TC Accession
Forward/Reverse Primer (5'-3') PCR
Size (bp)
Ubiquitin TC102473 AC137828_19.4 GCAGATAGACACGCTGGGA / AACTCTTGGGCAGGCAATAA 100 0.95 1.00
  1. Mean PCR efficiency (E) was determined from three biological replicates of each of six organs, using LinRegPCR [31], which also yielded mean R2. N, no corresponding GenBank accession number.