Skip to main content

Advertisement

Table 2 Medicago reference genes and primers for qRT-PCR

From: A community resource for high-throughput quantitative RT-PCR analysis of transcription factor gene expression in Medicago truncatula

Gene Name TC Accession Number Forward/Reverse Primer (5'-3') PCR Product Size (bp) PCR efficiency (E) R2
β Tubulin TC106341 N TTTGCTCCTCTTACATCCCGTG / GCAGCACACATCATGTTTTTGG 100 1.08 1.00
PPRrep TC96273 N GGAAAACTGGAGGATGCACGTA / ACAAGCCCTCGACACAAAACC 100 0.93 1.00
PDF 2 TC107161 N GTGTTTTGCTTCCGCCGTT / CCAAATCTTGCTCCCTCATCTG 100 0.99 1.00
bHLH CX538576 N TAGCGAGTACCATGATGCCAGA / GCGCCTCTTTTGTTTTCAGC 100 0.89 1.00
UBC AW686873 N CTGACAGCCCACTGAATTGTGA / TTTTGGCATTGCTGCAAGC 100 0.96 1.00
PTB TC111751 N CGCCTTGTCAGCATTGATGTC / TGAACCAGTGCCTGGAATCCT 100 0.85 1.00
Ubiquitin TC102473 AC137828_19.4 GCAGATAGACACGCTGGGA / AACTCTTGGGCAGGCAATAA 100 0.95 1.00
UBC9 TC106312 AC137602_2.4 GGTTGATTGCTCTTCTCTCCCC / AAGTGATTGCTCGTCCAACCC 100 1.13 0.99
Helicase CB892427 N GTACGAGGTCGGTGCTCTTGAA / GCAACCGAAAATTGCACCATAC 100 0.91 1.00
ELF1α EST317575 N GACAAGCGTGTGATCGAGAGATT / TTTCACGCTCAGCCTTAAGCT 100 0.68 0.98
UPL7 TC111218 N CCAGTTGTTCTCGTGGTCCATT / CCTCCAATTGTCGCCCAAA 100 0.93 1.00
GAPDH MtC00030_GC CT573421_3.4 TGCCTACCGTCGATGTTTCAGT / TTGCCCTCTGATTCCTCCTTG 100 1.04 0.99
Actin2 TC107326 AC137836_27.5 TCAATGTGCCTGCCATGTATGT / ACTCACACCGTCACCAGAATCC 100 1.12 0.99
MSC27 X63872 (M. sativa) N GTTGAAGTAGACATTGGTGCTAACG / AGCTGAGTCATCAACACCCTCAT 100 0.76 0.99
  1. Mean PCR efficiency (E) was determined from three biological replicates of each of six organs, using LinRegPCR [31], which also yielded mean R2. N, no corresponding GenBank accession number.