- Review
- Open Access
Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system
- Khaoula Belhaj†1,
- Angela Chaparro-Garcia†1,
- Sophien Kamoun1Email author and
- Vladimir Nekrasov1Email author
https://doi.org/10.1186/1746-4811-9-39
© Belhaj et al.; licensee BioMed Central Ltd. 2013
- Received: 12 September 2013
- Accepted: 7 October 2013
- Published: 11 October 2013
Abstract
Targeted genome engineering (also known as genome editing) has emerged as an alternative to classical plant breeding and transgenic (GMO) methods to improve crop plants. Until recently, available tools for introducing site-specific double strand DNA breaks were restricted to zinc finger nucleases (ZFNs) and TAL effector nucleases (TALENs). However, these technologies have not been widely adopted by the plant research community due to complicated design and laborious assembly of specific DNA binding proteins for each target gene. Recently, an easier method has emerged based on the bacterial type II CRISPR (clustered regularly interspaced short palindromic repeats)/Cas (CRISPR-associated) immune system. The CRISPR/Cas system allows targeted cleavage of genomic DNA guided by a customizable small noncoding RNA, resulting in gene modifications by both non-homologous end joining (NHEJ) and homology-directed repair (HDR) mechanisms. In this review we summarize and discuss recent applications of the CRISPR/Cas technology in plants.
Keywords
- CRISPR
- Cas9
- Plant
- Genome editing
- Genome engineering
- Targeted mutagenesis
Introduction
Targeted genome engineering has emerged as an alternative to classical plant breeding and transgenic (GMO) methods to improve crop plants and ensure sustainable food production. However, until recently the available methods have proven cumbersome. Both zinc finger nucleases (ZFNs) and TAL effector nucleases (TALENs) can be used to mutagenize genomes at specific loci, but these systems require two different DNA binding proteins flanking a sequence of interest, each with a C-terminal FokI nuclease module. As a result these methods have not been widely adopted by the plant research community. Earlier this year, a new method based on the bacterial CRISPR (clustered regularly interspaced short palindromic repeats)/Cas (CRISPR-associated) type II prokaryotic adaptive immune system [1] has emerged as an alternative method for genome engineering. The ability to reprogram CRISPR/Cas endonuclease specificity using customizable small noncoding RNAs has set the stage for novel genome editing applications [2–8]. The system is based on the Cas9 nuclease and an engineered single guide RNA (sgRNA) that specifies a targeted nucleic acid sequence. Given that only a single RNA is required to generate target specificity, the CRISPR/Cas system promises to be more easily applicable to genome engineering than ZFNs and TALENs.
Recently, eight reports describing the first applications of the Cas9/sgRNA system to plants have been published [9–16]. In this review, we summarise the methods and findings described in these publications and provide an outlook for the application of the CRISPR/Cas system as a genome engineering tool in plants.
Plant genome editing using the CRISPR/Cas system
Schematic drawing illustrating examples of genome editing assays in plants. The CRISPR/Cas9 technology was successfully applied in model plants (Nicotiana benthamiana, Arabidopsis thaliana) and crops (rice, wheat). The Cas9 nuclease and the sgRNA matching the gene of interest are co-expressed using Agrobacterium tumefaciens as a vector in N. benthamiana leaves or transfected into protoplasts from Arabidopsis, wheat or rice. Then, the genomic DNA is extracted from the leaf tissues or protoplasts and subject to PCR-amplification with primers flanking the target site. The presence of Cas9/sgRNA-induced mutations can be easily detected using the restriction enzyme (RE) site loss method. The RE-resistant band (lane 3) can be cloned. The exact nature of the mutations is then revealed by sequencing individual clones.
Summary of CRISPR/Cas genome editing assays in plants
Material/activity | A. thaliana | N. benthamiana | O. sativa | T. aestivum | S. bicolor | Reference |
---|---|---|---|---|---|---|
Cas9 | ||||||
Codon-optimized for plants | Yes | Yes | Yes | Yes | Yes | |
No | No | No | ||||
Number of NLS | 2 | 2 | 2 | 2 | ||
1 | ||||||
1 | 1 | N/A | [16] | |||
1 | ||||||
Intron introduced | Yes | Yes | [11] | |||
No | No | No | No | No | ||
Promoter | 35S PPDK | 35S PPDK | [11] | |||
2x CaMV 35S | 2x CaMV 35S | 2x CaMV 35S | ||||
CaMV 35S | CaMV 35S | CaMV 35S | ||||
OsAct1 | [16] | |||||
AtUBQ | OsUBQ | [13] | ||||
ZmUBQ | [15] | |||||
sgRNA | ||||||
Promoter | AtU6 | AtU6 | ||||
OsU3 | ||||||
OsU6 | OsU6 | [16] | ||||
TaU6 | [10] | |||||
Assays | ||||||
AtPDS3 | OsPDS | |||||
AtFLS2 | OsBADH2 | |||||
AtBRI1 | OsMPK2 | |||||
AtJAZ1 | Os02g23823 | |||||
AtGAI | OsROC5 | |||||
AtCHL1 | OsSPP | |||||
Genes targeted | AtCHL2 | NbPDS | OsYSA | TaMLO | N/A | |
At5g13930 | OsMYB1 | |||||
OsMPK5 | ||||||
OsCAO1 | ||||||
OsLAZY1 | ||||||
OsSWEET11 | ||||||
OsSWEET14 | ||||||
Transient assays | ||||||
Protoplasts | Yes | Yes | Yes | Yes | No | |
NHEJ mutation frequency | 1.1-5.6% [11] | 37.7-38.5% [11] | 14.5-38% [10] | 28-29% [10] | ||
3-8% [14] | ||||||
HDR modification frequency | 18.8% [12]* | 9% [11] | 6.9% [10] | |||
42% [13]* | ||||||
Leaf agroinfiltration | Yes | Yes | No | No | No | |
NHEJ mutation frequency | 2.7% [11] | 4.8% [11] | ||||
2.1% [9] | ||||||
Embryo transformation | No | No | No | No | Yes | [16] |
NHEJ mutation frequency | 28% | |||||
Transgenic mutants | ||||||
Mutated plants recovered | Yes | Yes | Yes | N/A | N/A | |
Frequency of modified plants | 30-84% [12] | 6.7% [9] | 4-9.4% [10] | |||
76-89% [13] | 5-75% [12] | |||||
50% [13] | ||||||
83-91.6% [15] | ||||||
Biallelic mutations recovered | N/A | N/A | ||||
Off-targets | ||||||
Off-target detected | N/A | No [9] | N/A | N/A |
Cas9 nuclease for plant genome editing
Cas9, a hallmark protein of the type II CRISPR-Cas system, is a large monomeric DNA nuclease guided to a DNA target sequence adjacent to the PAM (protospacer adjacent motif) sequence motif by a complex of two noncoding RNAs: CRIPSR RNA (crRNA) and trans-activating crRNA (tracrRNA) [1, 2, 18]. In August 2012, Jinek et al. showed that a synthetic RNA chimera (single guide RNA, or sgRNA) created by fusing crRNA with tracrRNA is functional to a similar level as the crRNA and tracrRNA complex. As a result, the number of components in the CRISPR/Cas system was brought down to two, Cas9 and sgRNA [2].
Cas9 variants used for genome editing in plants. The Cas9 nuclease was expressed as a fusion protein with a tag (FLAG or GFP as indicated) under various constitutive promoters. Diagonal lines indicate an intron inserted into the Cas9 gene. NLS, nuclear localization signal.
Li et al. introduced an intron into the Cas9 gene (Table 1 and Figure 2) to prevent its expression and avoid toxicity in bacteria but this doesn’t seem to be necessary for delivery by A. tumefaciens.
As in the case of human cells [4, 5], the Cas9 protein was expressed in plants as a fusion to a nuclear localization signal (NLS) to ensure delivery into nuclei. Cas9 was fused to either a single NLS or was flanked by two NLSs, and, as in human cells, both versions appear to be functional (Table 1 and Figure 2). In addition, six studies used a Cas9 version with a tag (FLAG or GFP), while two studies used a non-tagged Cas9 (Figure 2), suggesting that tagging the protein does not compromise the endonuclease activity in planta. Four different promoters were used to drive Cas9 expression with the Cauliflower mosaic virus 35S promoter being the most commonly used (Figure 2).
In summary, all tested versions of Cas9 seem to work in plants and very high rates of mutant transgenic plants, generated using the CRISPR/Cas system, have been reported (up to 89% for Arabidopsis and up to 92% for rice) with biallelic mutation being recovered in the case of both plant species (Table 1).
Although the discussed studies provide an insight into functional Cas9 configurations, further studies and side-by-side experiments are required to investigate whether some promoters and Cas9 combinations are more effective than others in plants.
sgRNAs for plant genome editing
Scheme illustrating the sgRNA structure and mechanism of the target recognition. sgRNA is expressed under the U6 promoter in A. thaliana, N. benthamiana, O. sativa, T. aestivum and S. bicolor, and under the U3 promoter in O. sativa. The transcript initiation nucleotide in the case of U6p and U3p is “G” and “A”, respectively.
In plants, sgRNAs have been expressed using plant RNA polymerase III promoters, such as U6 and U3 (Table 1 and Figure 3). These promoters have a defined transcription start nucleotide, which is “G” or “A”, in the case of U6 or U3 promoters, respectively (Figure 3). Therefore, the guide sequences in the sgRNAs, used to target plant genomic loci, follow the consensus G(N)19–22 for the U6 promoter and A(N)19–22 for the U3 promoter, where the first G or A may or may not pair up with the target DNA sequence [9–16]. On the other hand, in mammalian systems, sgRNA guide sequences normally follow the consensus G(N)19–20 where the first G may or may not pair up with the target [20, 21].
CRISPR/Cas genome editing assays in plants
In plants the CRISPR/Cas9 system has been implemented using transient expression systems, therefore enabling rapid execution and optimization of the method. Widely used transient assays in plant research are (i) protoplast transformation and (ii) leaf tissue transformation using the agroinfiltration method. Both methods have been used for Cas9 and sgRNA (Figure 1). The advantage of the protoplast strategy is the possibility to achieve high levels of gene co-expression even from separate plasmids. However, isolation of protoplasts from plant tissue requires enzymatic digestion and removal of the cell wall. The procedure can be time consuming, and protoplast cultures are fragile and prone to contamination. An alternative is the agroinfiltration assay, which is performed on intact plants, and relatively less time consuming compared to protoplasts. This system is based on infiltration of A. tumefaciens strains carrying a binary plasmid that contains the candidate genes to be expressed [17]. Efficiency of gene co-expression by agroinfiltration appears to be lower than in protoplasts, and combining multiple genes of interest in one vector is preferable. However, not all plant species are amenable to transformation by these methods and options can be limited depending on the plant species of interest.
To readily detect induced mutations generated by the CRISPR/Cas method, one approach is to target a restriction enzyme site and use the restriction enzyme site loss assay described below (Figure 1). Since the Cas9 nuclease introduces a blunt cut in the DNA predominantly 3 bp away from the PAM (Figure 3), it is advantageous to identify a DNA target with an overlapping restriction site proximal to the PAM motif. In this case, the repair of a DSB via the error-prone NHEJ pathway will result in mutations that will disrupt the restriction site. Therefore, mutations can be detected by amplifying the genomic DNA across the target and digesting resulting amplicons with the restriction enzyme (Figure 1). This assay can be more sensitive when the PCR-amplification is performed on genomic DNA template pre-digested with the restriction enzyme [9, 16].
An alternative assay is the Surveyor assay [22]. PCR-amplified DNA from the Cas9/sgRNA treated sample is first denatured and then allowed to anneal before being subject to CELI or T7 endonuclease I that cleave hetero-duplexes formed by the WT and the mutated DNA [13, 14]. It is worth considering that the Surveyor assay is less sensitive than the restriction enzyme site loss assay and requires a higher rate of mutagenesis to be successfully applied. However, it can in principle be applied to any target sequence.
Generation of a chromosomal deletion by targeting two adjacent sequences within the PDS locus of Nicotiana benthamiana. A. Cartoon explaining setup of the experiment. B. Detection of deletion mutations using the AFLP analysis. Agarose gel shows PCR bands amplified across targets 1 and 2 using genomic DNA extracted from respective leaf samples. Cas9, sgRNA1 and 2 were expressed in N. benthamiana leaf tissue using the standard agroinfiltration protocol. In lane 2, Cas9/sgRNA1/sgRNA2 were expressed from three separate plasmids, while in lane 4 they were expressed from a single plasmid. C. Types of deletion mutations identified. Bottom PCR bands from lanes 2 and 4 were cloned into a high copy vector and 15 individual clones were sequenced. All clones contained deletions that can be grouped in three different types (m1-3).
Homology-directed repair (HDR) using CRISPR/Cas system in plants
The DSB introduced by Cas9 nuclease guided by an sgRNA can be repaired via either the cell’s NHEJ or HDR mechanisms. NHEJ can be harnessed to generate single and multiple gene knock-outs as well as large chromosomal deletions following cuts generated by CRISPR/Cas. HDR, on the other hand, enables targeted gene insertions (e.g. introducing a green fluorescent protein GFP tag into a genomic locus) or gene replacements (e.g. introducing a SNP into a gene of interest) [22]. HDR-dependent genome editing using the CRISPR system has been achieved in N. benthamiana[11] and rice [10]. The donor DNA, which is used as a repair template, was delivered into protoplasts as a single stranded oligo [10] or as a double stranded DNA fragment [11]. The next challenge would be to regenerate whole plants from protoplasts and so far this is only possible for some plant species (e.g. N. benthamiana and Arabidopsis).
HDR using CRISPR/Cas system has not yet been achieved in plants using A. tumefaciens delivery. In principle, the DNA repair template can be delivered together with the Cas9 and sgRNA in a T-DNA carrying all three components as reported for the I-SceI meganuclease [23]. For plant species that are not amenable to transformation by A. tumefaciens and cannot be regenerated out of protoplasts, the Cas9/sgRNA and donor DNA can be delivered into plant cells by callus bombardment as described for cotton in D’Halluin et al. [24].
HDR-mediated genome editing can be problematic due to intrinsically low efficiency of homologous recombination (HR) as in the case of Arabidopsis [11]. The NHEJ DNA repair pathway is antagonistic to the HDR pathway. Therefore, HDR efficiency can be increased using mutants compromised in the NHEJ DNA repair mechanism (e.g. ku70 and lig4). In Arabidopsis, an increase of 5–16 fold in HDR-mediated gene targeting has been reported for the ku70 mutant and 3–4 fold for the lig4 mutant [25]. Once the desired gene-targeting event is produced, the ku70 or lig4 mutations can be crossed out of the mutant plants.
Off-target mutations and plant genome editing
Target specificity is an important issue for all genome editing technologies, including CRISPR/Cas. Recently, a number of reports have systematically examined specificity of the CRISPR/Cas system in human cells as well as in vitro[26–30]. The main conclusion is that the 3′ end of the guide sequence within the sgRNA predominantly confers target specificity of the CRISPR/Cas system. This is consistent with earlier reports [2, 5, 8]. Mismatches between the DNA target and the guide sequence of the sgRNA located within the last 8–10 bp of the 20 bp target sequence often abolish the target recognition by Cas9, while mismatches towards the 5′ end of the target are better tolerated. Presence of the PAM motif (NGG) right after the 20 bp target is essential, although Hsu et al. reported that a variant of the PAM with a noncanonical NAG sequence retains some activity [29]. Importantly, the number and position of tolerable mismatches between the DNA target and the guide sequence is target-dependent and users should be careful not to generalize the reported rates [26, 29].
How prone is the CRISPR system to off-target activity when applied in plants? Off-targets were addressed in four reports [9–11, 14]. Two of them detected experimental evidence of off-target activity in rice [10, 14]. However, Nekrasov et al. did not detect off-target activity in N. benthamiana for 18 off-sites with sequence similarity to the target [9]. Overall, the number of tested off-sites in all studies was relatively small and general conclusions would be premature. A comprehensive study based on whole genome sequencing of mutant plants is required to fully address this issue in planta.
Off-target mutations by the CRISPR system can be minimised by selecting target sequences that have reduced numbers of off-targets in the genome. Examples of algorithms for selecting specific targets have been reported for Arabidopsis and rice [11, 14, 15]. In any case, off-target mutations are less problematic in plants compared to animals, because they can easily be crossed out.
Outlook
The CRISPR/Cas technology has enormous potential as a straightforward genome-editing tool for basic and applied plant research. Considering the number of reports that have already been published on plant applications, the method appears to be easily applicable and robust. The major advantage of the CRISPR/Cas technology over ZFNs and TALENs is that the method does not require elaborate design and time-consuming assembly of individual DNA-binding proteins. In contrast, the CRISPR/Cas system is versatile and only requires a single Cas9 nuclease that can be programmed by engineering the sgRNA.
Until recently, the possibility of recovering knockout lines by conventional reverse genetic approaches (T-DNA, TILLING) for a specific gene has been dictated by chance. The shorter the gene, the lower the probability to hit it with a T-DNA insertion or a mutation. Routine targeted mutagenesis opens up a new dimension in plant biology and should help to generate mutants in previously difficult to access genes, as well as simultaneously mutate multiple loci and generate large deletions [11, 13]. The likelihood of targeting a specific genomic locus is probably affected by various factors (e.g. chromatin context) but Cas9 does not seem to be affected by DNA methylation, at least in human cells [29].
We foresee the CRISPR technology to become a routine method in plants for making targeted single and multiple gene knock-outs, introducing SNPs into a gene of interest, expressing proteins tagged with affinity or fluorescent tags at their native loci in the genome and much more. However, some questions remain to be addressed as the technology has only been implemented for a few months. One of the outstanding issues is whether genetic changes induced by Cas9/sgRNA can be inherited by the plant germline and transferred to subsequent generations. Genotyping the progeny of plants carrying Cas9/sgRNA induced mutations will answer this question. The relatively high off-target rate of the CRISPR system could be an issue as well. However, off-target effect can be minimised by making an informed decision about the choice of target sequence within a gene according to the algorithms described [11, 14, 15]. The plant field will soon benefit from an online tool analogous to http://crispr.mit.edu/[29] for designing CRISPR targets with a minimum off-target effect in various plant species. As mentioned earlier, the off-target mutations in plants are less problematic compared to human or animals as they can be easily bred out.
Like ZFNs and TALENs, the CRISPR technology has become one of the new plant breeding techniques (NPBTs). NPBTs are currently debated by advisory and regulatory authorities in Europe and worldwide in relation to the GMO legislation [31–34]. These techniques make possible introducing plant genome modifications, which are indistinguishable from those introduced by conventional breeding and chemical or physical mutagenesis. As a result, crop varieties produced using the above mentioned technologies may be classified as non-GM. Excluding such crop varieties from the scope of the GMO legislation, especially in Europe, would have an enormous positive impact on the development of the plant biotechnology and breeding sector.
Materials and methods
Plasmid construction
Primers used in this study
Primer name | Sequence 5′ to 3′ |
---|---|
PDS_gRNA1_BsaIf | TGTGGTCTCAATTGCCGTTAATTTGAGAGTCCAGTTTTAGAGCTAGAAATAGCAAG |
PDS_gRNA2_BsaIf | TGTGGTCTCAATTGTCAAGATGTTTGCTTGCAAGTTTTAGAGCTAGAAATAGCAAG |
gRNA_AGCG_BsaIr | TGTGGTCTCAAGCGTAATGCCAACTTTGTAC |
Cas9_1f | GAGGAAGACAAAATGGACAAGAAGTACTCCATTGGG |
Cas9_1r | GAGGAAGACAAAGTCTCTTCTGATTTGCGAGTCATCCA |
Cas9_2f | GAGGAAGACAAGACTATCACTCCCTGGAACTTCGAG |
Cas9_2r | GAGGAAGACAAATCTTCTTTGAGCTGTTTCACGGTAACT |
Cas9_3f | GAGGAAGACAAAGATTATTTCAAAAAGATTGAATG |
Cas9_3r | GAGGAAGACAAGAGACTGTCCCCCTGGCCAGAAACTTG |
Cas9_4f | GAGGAAGACAATCTCCACGAGCACATCGCTAATCTTGCAGG |
Cas9_4r | GAGGAAGACAAGAAACCAGCTTAGACTTCAGAGTAATA |
Cas9_5f | GAGGAAGACAATTTCAGATTTCAGAAAGGACTTTCAG |
Cas9_5r | GAGGAAGACAAAGATCCTTTGAGCTTTTCATAGTGGCTGG |
Cas9_6f | GAGGAAGACAAATCTCCCGAAGATAATGAGCAGAAG |
Cas9_6-1r | GAGGAAGACAAAAGCTCACACCTTCCTCTTCTTCTTGG |
PDS_MlyIF | GCTTTGCTTGAGAAAAGCTCTC |
PDSseqr5 | TTTAAAGGATTAAAGTCCTTTGTCA |
M13 forward | GTTGTAAAACGACGGCCAGT |
M13 reverse | CAGGAAACAGCTATGACC |
In the case of the lane 4 (Figure 4B), Cas9 and both sgRNA1 and 2 were expressed in N. benthamiana from the single construct pAGM4723::AtU6p::sgRNA2-2x35S-5′UTR::Cas9::NOST-AtU6p::sgRNA1 as described above for the lane 2. The construct was assembled using the Golden Gate (GG) cloning method [35] as following. sgRNA1 was PCR-amplified with primers PDS_gRNA1_BsaIf and gRNA_AGCG_BsaIr, and sgRNA2 – with primers PDS_gRNA2_BsaIf and gRNA_AGCG_BsaIr using the plasmid gRNA_GFP_T1 [4] as a template. Both sgRNA1 and sgRNA2 PCR products were cut-ligated with the AtU6p level 0 module [9] into pICH47751 and pICH47732 level 1 vectors [35] respectively using BsaI.
In order to use the human codon optimised Cas9 [4] in the GG system, all BsaI and BbsI sites had to be removed from its sequence, while preserving the amino acid composition of the protein, in a process called “domestication”. Fragments of the Cas9 coding sequence were amplified with six pairs of primers: Cas9_1f/Cas9_1r, Cas9_2f/Cas9_2r, Cas9_3f/Cas9_3r, Cas9_4f/Cas9_4r, Cas9_5f/Cas9_5r and Cas9_6f/Cas9_6-1r using the clone described in Mali et al. as a template. The resulting PCR fragments were cloned into the pCR-Blunt II-TOPO vector (Life Technologies). All six cloned fragments of Cas9 were then cut-ligated into a level 0 vector [35] using BbsI. The resulting Cas9 level 0 module was combined with 2x35S-5′UTR (pICH51288) and NOST (pICH41421) level 0 modules (provided by S. Marillonnet) and cut-ligated into the pICH47742 level 1 vector [35] using BsaI.
pICH47732::AtU6p::sgRNA2, pICH47742::2x35S-5′UTR::Cas9::NOST and pICH47751::AtU6p::sgRNA1 level 1 constructs plus pELE-3 linker [35] were cut-ligated into the pAGM4723 level 2 vector (provided by S. Marillonnet) using BbsI. The resulting level 2 construct pAGM4723::AtU6p::sgRNA2-2x35S-5′UTR::Cas9::NOST-AtU6p::sgRNA1 was transformed into the AGL1 strain of A. tumifaciens.
Transient gene expression in N. benthamiana
Transient expression was performed using the AGL1 strain of A. tumefaciens as described in Bos et al. [36].
Detection of Cas9-induced deletions in plant genomic DNA
Cas9 and sgRNAs were transiently co-expressed in the N. benthamiana leaf tissue. The tissue was harvested at 2 days post infiltration and the genomic DNA extracted using the DNeasy Plant Mini kit (Qiagen). 50 ng of DNA was added in a PCR reaction and amplified with PDS_MlyIF and PDSseqr5 primers using the Phusion DNA polymerase (New England Biolabs). PCR products were run on a 3% agarose gel. The DNA from bottom bands in lanes 2 and 4 (Figure 4) was extracted and cloned into pCR-Blunt II-TOPO vector (Life Technologies). 15 individual clones were sequenced using standard M13 forward and M13 reverse primers.
Notes
Declarations
Acknowledgements
We thank Jonathan D. G. Jones for help with designing the Cas9 domestication strategy, Sylvestre Marillonnet and Icon Genetics, Halle, Germany for providing plasmid vectors, and the LFCats for discussion. This work was supported by the Gatsby Charitable Foundation, the European Research Council (ERC), and the Biotechnology and Biological Sciences Research Council (BBSRC).
Authors’ Affiliations
References
- Sorek R, Lawrence CM, Wiedenheft B: CRISPR-mediated adaptive immune systems in bacteria and archaea. Annu Rev Biochem 2013, 82: 237-266. 10.1146/annurev-biochem-072911-172315View ArticlePubMedGoogle Scholar
- Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E: A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337: 816-821. 10.1126/science.1225829View ArticlePubMedGoogle Scholar
- Jinek M, East A, Cheng A, Lin S, Ma E, Doudna J: RNA-programmed genome editing in human cells. Elife 2013, 2: e00471. 10.7554/eLife.00471PubMed CentralView ArticlePubMedGoogle Scholar
- Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE, Church GM: RNA-guided human genome engineering via Cas9. Science 2013, 339: 823-826. 10.1126/science.1232033PubMed CentralView ArticlePubMedGoogle Scholar
- Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F: Multiplex genome engineering using CRISPR/Cas systems. Science 2013, 339: 819-823. 10.1126/science.1231143PubMed CentralView ArticlePubMedGoogle Scholar
- Cho SW, Kim S, Kim JM, Kim JS: Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol 2013, 31: 230-232. 10.1038/nbt.2507View ArticlePubMedGoogle Scholar
- Hwang WY, Fu Y, Reyon D, Maeder ML, Tsai SQ, Sander JD, Peterson RT, Yeh JR, Joung JK: Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol 2013, 31: 227-229. 10.1038/nbt.2501PubMed CentralView ArticlePubMedGoogle Scholar
- Jiang W, Bikard D, Cox D, Zhang F, Marraffini LA: RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol 2013, 31: 233-239. 10.1038/nbt.2508PubMed CentralView ArticlePubMedGoogle Scholar
- Nekrasov V, Staskawicz B, Weigel D, Jones JD, Kamoun S: Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nat Biotechnol 2013, 31: 691-693. 10.1038/nbt.2655View ArticlePubMedGoogle Scholar
- Shan Q, Wang Y, Li J, Zhang Y, Chen K, Liang Z, Zhang K, Liu J, Xi JJ, Qiu JL, Gao C: Targeted genome modification of crop plants using a CRISPR-Cas system. Nat Biotechnol 2013, 31: 686-688. 10.1038/nbt.2650View ArticlePubMedGoogle Scholar
- Li JF, Norville JE, Aach J, McCormack M, Zhang D, Bush J, Church GM, Sheen J: Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotechnol 2013, 31: 688-691. 10.1038/nbt.2654PubMed CentralView ArticlePubMedGoogle Scholar
- Feng Z, Zhang B, Ding W, Liu X, Yang DL, Wei P, Cao F, Zhu S, Zhang F, Mao Y, Zhu JK: Efficient genome editing in plants using a CRISPR/Cas system. Cell Res 2013, 23: 1229-1232. 10.1038/cr.2013.114PubMed CentralView ArticlePubMedGoogle Scholar
- Mao Y, Zhang H, Xu N, Zhang B, Gao F, Zhu JK: Application of the CRISPR-Cas system for efficient genome engineering in plants. Mol Plant doi:10.1093/mp/sst121 (August 20, 2013)Google Scholar
- Xie K, Yang Y: RNA-guided genome editing in plants using a CRISPR-Cas system. Mol Plant doi:10.1093/mp/sst119 (August 17, 2013)Google Scholar
- Miao J, Guo D, Zhang J, Huang Q, Qin G, Zhang X, Wan J, Gu H, Qu LJ: Targeted mutagenesis in rice using CRISPR-Cas system. Cell Res 2013, 23: 1233-1236. 10.1038/cr.2013.123PubMed CentralView ArticlePubMedGoogle Scholar
- Jiang W, Zhou H, Bi H, Fromm M, Yang B, Weeks DP: Demonstration of CRISPR/Cas9/sgRNA-mediated targeted gene modification in Arabidopsis, tobacco, sorghum and rice. Nucleic Acids Res doi:10.1093/nar/gkt780 (September 2, 2013)Google Scholar
- Van der Hoorn RA, Laurent F, Roth R, De Wit PJ: Agroinfiltration is a versatile tool that facilitates comparative analyses of Avr9/Cf-9-induced and Avr4/Cf-4-induced necrosis. Mol Plant Microbe Interact 2000, 13: 439-446. 10.1094/MPMI.2000.13.4.439View ArticlePubMedGoogle Scholar
- Deltcheva E, Chylinski K, Sharma CM, Gonzales K, Chao Y, Pirzada ZA, Eckert MR, Vogel J, Charpentier E: CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III. Nature 2011, 471: 602-607. 10.1038/nature09886PubMed CentralView ArticlePubMedGoogle Scholar
- Mussolino C, Cathomen T: RNA guides genome engineering. Nat Biotechnol 2013, 31: 208-209. 10.1038/nbt.2527View ArticlePubMedGoogle Scholar
- Yang H, Wang H, Shivalila CS, Cheng AW, Shi L, Jaenisch R: One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell 2013, 154: 1370-1379. 10.1016/j.cell.2013.08.022PubMed CentralView ArticlePubMedGoogle Scholar
- Wang HY, Yang H, Shivalila CS, Dawlaty MM, Cheng AW, Zhang F, Jaenisch R: One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell 2013, 153: 910-918. 10.1016/j.cell.2013.04.025PubMed CentralView ArticlePubMedGoogle Scholar
- Voytas DF: Plant genome engineering with sequence-specific nucleases. Annu Rev Plant Biol 2013, 64: 327-350. 10.1146/annurev-arplant-042811-105552View ArticlePubMedGoogle Scholar
- Fauser F, Roth N, Pacher M, Ilg G, Sanchez-Fernandez R, Biesgen C, Puchta H: In planta gene targeting. Proc Natl Acad Sci USA 2012, 109: 7535-7540. 10.1073/pnas.1202191109PubMed CentralView ArticlePubMedGoogle Scholar
- D’Halluin K, Vanderstraeten C, Van Hulle J, Rosolowska J, Van Den Brande I, Pennewaert A, D’Hont K, Bossut M, Jantz D, Ruiter R, Broadhvest J: Targeted molecular trait stacking in cotton through targeted double-strand break induction. Plant Biotechnol J 2013, 11: 933-941. 10.1111/pbi.12085PubMed CentralView ArticlePubMedGoogle Scholar
- Qi Y, Zhang Y, Zhang F, Baller JA, Cleland SC, Ryu Y, Starker CG, Voytas DF: Increasing frequencies of site-specific mutagenesis and gene targeting in Arabidopsis by manipulating DNA repair pathways. Genome Res 2013, 23: 547-554. 10.1101/gr.145557.112PubMed CentralView ArticlePubMedGoogle Scholar
- Fu Y, Foden JA, Khayter C, Maeder ML, Reyon D, Joung JK, Sander JD: High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol 2013, 31: 822-826. 10.1038/nbt.2623PubMed CentralView ArticlePubMedGoogle Scholar
- Pattanayak V, Lin S, Guilinger JP, Ma E, Doudna JA, Liu DR: High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity. Nat Biotechnol 2013, 31: 839-843. 10.1038/nbt.2673PubMed CentralView ArticlePubMedGoogle Scholar
- Mali P, Aach J, Stranges PB, Esvelt KM, Moosburner M, Kosuri S, Yang L, Church GM: CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol 2013, 31: 833-838. 10.1038/nbt.2675View ArticlePubMedGoogle Scholar
- Hsu PD, Scott DA, Weinstein JA, Ran FA, Konermann S, Agarwala V, Li Y, Fine EJ, Wu X, Shalem O, et al.: DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol 2013, 31: 827-832. 10.1038/nbt.2647PubMed CentralView ArticlePubMedGoogle Scholar
- Carroll D: Staying on target with CRISPR-Cas. Nat Biotechnol 2013, 31: 807-809. 10.1038/nbt.2684View ArticlePubMedGoogle Scholar
- Lusser M, Davies HV: Comparative regulatory approaches for groups of new plant breeding techniques. N Biotechnol 2013, 30: 437-446. 10.1016/j.nbt.2013.02.004View ArticlePubMedGoogle Scholar
- Lusser M, Parisi C, Plan D, Rodriguez-Cerezo E: Deployment of new biotechnologies in plant breeding. Nat Biotechnol 2012, 30: 231-239. 10.1038/nbt.2142View ArticlePubMedGoogle Scholar
- Pauwels K, Podevin N, Breyer D, Carroll D, Herman P: Engineering nucleases for gene targeting: safety and regulatory considerations. N Biotechnol doi:10.1016/j.nbt.2013.07.001 (July 12, 2013)Google Scholar
- Kuzma J, Kokotovich A: Renegotiating GM crop regulation. Targeted gene-modification technology raises new issues for the oversight of genetically modified crops. EMBO Rep 2011, 12: 883-888. 10.1038/embor.2011.160PubMed CentralView ArticlePubMedGoogle Scholar
- Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S: A modular cloning system for standardized assembly of multigene constructs. PLoS One 2011, 6: e16765. 10.1371/journal.pone.0016765PubMed CentralView ArticlePubMedGoogle Scholar
- Bos JI, Kanneganti TD, Young C, Cakir C, Huitema E, Win J, Armstrong MR, Birch PR, Kamoun S: The C-terminal half of Phytophthora infestans RXLR effector AVR3a is sufficient to trigger R3a-mediated hypersensitivity and suppress INF1-induced cell death in Nicotiana benthamiana. Plant J 2006, 48: 165-176. 10.1111/j.1365-313X.2006.02866.xView ArticlePubMedGoogle Scholar
Copyright
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.