Skip to main content

Advertisement

Table 2 Primers used in this study

From: Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system

Primer name Sequence 5′ to 3′
PDS_gRNA1_BsaIf TGTGGTCTCAATTGCCGTTAATTTGAGAGTCCAGTTTTAGAGCTAGAAATAGCAAG
PDS_gRNA2_BsaIf TGTGGTCTCAATTGTCAAGATGTTTGCTTGCAAGTTTTAGAGCTAGAAATAGCAAG
gRNA_AGCG_BsaIr TGTGGTCTCAAGCGTAATGCCAACTTTGTAC
Cas9_1f GAGGAAGACAAAATGGACAAGAAGTACTCCATTGGG
Cas9_1r GAGGAAGACAAAGTCTCTTCTGATTTGCGAGTCATCCA
Cas9_2f GAGGAAGACAAGACTATCACTCCCTGGAACTTCGAG
Cas9_2r GAGGAAGACAAATCTTCTTTGAGCTGTTTCACGGTAACT
Cas9_3f GAGGAAGACAAAGATTATTTCAAAAAGATTGAATG
Cas9_3r GAGGAAGACAAGAGACTGTCCCCCTGGCCAGAAACTTG
Cas9_4f GAGGAAGACAATCTCCACGAGCACATCGCTAATCTTGCAGG
Cas9_4r GAGGAAGACAAGAAACCAGCTTAGACTTCAGAGTAATA
Cas9_5f GAGGAAGACAATTTCAGATTTCAGAAAGGACTTTCAG
Cas9_5r GAGGAAGACAAAGATCCTTTGAGCTTTTCATAGTGGCTGG
Cas9_6f GAGGAAGACAAATCTCCCGAAGATAATGAGCAGAAG
Cas9_6-1r GAGGAAGACAAAAGCTCACACCTTCCTCTTCTTCTTGG
PDS_MlyIF GCTTTGCTTGAGAAAAGCTCTC
PDSseqr5 TTTAAAGGATTAAAGTCCTTTGTCA
M13 forward GTTGTAAAACGACGGCCAGT
M13 reverse CAGGAAACAGCTATGACC