Skip to main content
Download PDF

Detecting the colonization of ericoid mycorrhizal fungi in Vaccinium uliginosum using in situ polymerase chain reaction and green fluorescent protein

Plant Methods volume 16, Article number: 102 (2020) Cite this article

Abstract

Background

Ericoid mycorrhizal fungi (EMF) play important roles in mineral cycling and plant nutrient acquisition, and they increase plant survival in nutrient-poor environments. In this study, we detected the colonization of EMF using a green fluorescent protein (GFP) expression method and in situ PCR.

Results

Genetic transformants of Cryptosporiopsis ericae and Sordariomycetes sp. expressing GFP were obtained via Agrobacterium tumefaciens-mediated transformation. GFP transformants were able to infect Vaccinium uliginosum, and their fluorescence was visible in the hair roots. Both in situ PCR and the GFP-expressing method indicated that EMF could colonize the hair roots of V. uliginosum 2 weeks after inoculation.

Conclusions

This research represents the first attempt to detect ericoid mycorrhizal colonization using in situ PCR. A GFP-expressing method is an excellent system for detecting the colonization of EMF, but it is dependent on the successful transformation and expression of the gfp gene. In situ PCR and the GFP expression may be developed as new tools to study the interactions of EMF both with ericaceous plants and with the environment.

Background

Ericaceous plant species are widely distributed globally and are mostly found as understory species in the cold areas of boreal forests [1, 2]. The hair roots of ericaceous plants are profusely colonized by a specific mycorrhiza fungi, known as ericoid mycorrhizal fungi (EMF). EMF play an important role in mineral cycling and plant nutrient acquisition [2], and thus EMF increase the capability of a plant to survive in nutrient-poor environments [3]. EMF are important for both cultivated and wild ericaceous plants growing in stressful environments [4].

A deeper understanding of the EMF colonization process would be beneficial for the utilization of EMF in the cultivation of ericaceous plants [5]. The detection of colonization is a starting point in understanding how this symbiosis is established and functions [6]. Over the past few decades, many studies have isolated a large number of fungi from the roots of ericaceous plants and have inoculated them into sterile micropropagated seedlings to detect the colonization of inoculated fungi and their ability to form ericoid mycorrhiza [1, 7]. Currently, increasing numbers of fungal taxa forming ericoid mycorrhizae have been identified [7]. Several techniques, such as trypan blue staining, electron microscopy, immunofluorescence, and in situ hybridization [8,9,10], have been developed and used extensively in a variety of biological tissues to evaluate microorganism colonization. Most previous studies used trypan blue staining to investigate EMF colonization [11, 12]. Several fungi, such as members of the Phialocephalae-Acephala complex, are considered as putative EMF based on the detection of fungal colonization by trypan blue staining [9]. However, the status of fungal colonization remains questionable, and some fungal colonization is likely to be the result of opportunistic colonization [1]. Recently, in situ PCR and fluorescent reporter proteins were also introduced to analyze microorganism colonization [13, 14]. In situ PCR, which combines the advantages of high-efficiency PCR amplification and the precise localization of in situ hybridization, could help elucidate microbial distributions and microbe–host interactions [15]. In addition, in situ PCR has the ability to detect and illustrate microorganism distributions in tissue sections for single-copy molecules and is thus advantageous for the investigation of microorganism colonization [16, 17]. Fluorescent reporter proteins are also essential for studying microbe–host interactions [18]. Green fluorescent protein (GFP) is one of the most common fluorescent reporter proteins, and it has been used to detect fungi in planta and observe fungal distribution and proliferation [18, 19]. GFP has been successfully expressed in several fungi and is used widely for in planta visualization [18, 19]. The majority of studies on mycorrhizal fungi have focused on the transformation of arbuscular mycorrhizae (AM) fungi, and several AM fungi have been documented [20]. In a study on EMF, Martino et al. [13] reported the successful and stable transformation of GFP using protoplasts and Agrobacterium tumefaciens-mediated transformation methods. In this study, we detected the colonization of EMF using in situ PCR and a GFP expression method. Both in situ PCR and GFP expression indicated that EMF could colonize the hair roots of V. uliginosum 2 weeks after inoculation.

Results

Observation of the fungal colonization of V. uliginosum by scanning electron microscopy

Hair roots were collected from V. uliginosum growing in the Greater Khingan Mountains. Strain 103 of Cryptosporiopsis ericae was isolated from the hair roots of V. uliginosum. Micropropagated seedlings were inoculated with strain 103 of C. ericae. The fungal mycelia were observed to have colonized the hairs root by scanning electron microscopy. Several epidermal cells, which were located in the outermost cell layer of the hair roots, contained dense hyphal coils (Fig. 1). This feature was identical to that previously described for EMF [8]. Several epidermal cells were almost completely occupied by fungal hyphae (Fig. 1). Few fungal hyphae could be observed in the stele.

Fig. 1
figure 1

Observation of ericoid mycorrhizal roots from V. uliginosum by scanning electron microscopy. a Transverse sectional micrograph of an ericoid mycorrhizal root. EMF hyphal coils within the epidermal cells were labeled with asterisks. An epidermal cell was labeled with an arrowhead, and the magnified images for the cell are indicated in Figure b–d. Bars are 10 μm (a, b) and 1 μm (c, d)

Full size image

Root colonization by fungal transformants expressing GFP

Genetic transformants of strain 103 of C. ericae and strain 105 of Sordariomycetes sp. expressing the GFP were obtained via A. tumefaciens-mediated transformation. The specific GFP fragment was amplified using the total nucleic acids extracted from the hyphae as a template (data not shown). The fluorescence of the hyphae was observed by fluorescence microscopy (Fig. 2), and the fluorescence remained stable after repeated sub-culturing.

Fig. 2
figure 2

Microscopic images of C. ericae and Sordariomycetes sp. wild-type and GFP-transformed mycelia. No background signal is visible for the untransformed mycelia (a, e phase-contrast light images of C. ericae and Sordariomycetes sp.; b, f fluorescent light images of C. ericae and Sordariomycetes sp.). GFP expression in EMF is clearly visible in the hyphae as green fluorescence (c, g: phase-contrast light images of C. ericae and Sordariomycetes sp.; d, h fluorescent light images of C. ericae and Sordariomycetes sp.). All of the bars are 100 μm

Full size image

The ability of C. ericae and Sordariomycetes sp. transformants expressing GFP to form mycorrhizae with V. uliginosum seedlings was determined via fluorescence microscopy. GFP transformants were able to infect V. uliginosum, and their GFP was visible in the hair roots, although V. uliginosum exhibited weak autofluorescence (Fig. 3). Infection of the axenic V. uliginosum seedlings with the GFP fungal mutants resulted in typical ericoid mycorrhizae, with hyphal coils that completely or partially occupied the root epidermal cells.

Fig. 3
figure 3

Microscopic images of V. uliginosum roots colonized by C. ericae and Sordariomycetes sp. wild-type (a, bC. ericae; e, f Sordariomycetes sp.) and by C. ericae and Sordariomycetes sp. expressing GFP (c, dC. ericae; g, h Sordariomycetes sp.). a, c, e, g phase-contrast images; b, d, f, h fluorescent images. Fluorescent fungal coils are visible in the root cells colonized by C. ericae and Sordariomycetes sp. expressing GFP at 2 weeks (d, h). Weak autofluorescence was observed in the root sections of V. uliginosum (b, f). All of the bars are 100 μm

Full size image

The colonization characteristics of EMF were also assessed. The EMF could form hyphal coils 2 weeks after inoculation, as observed by fluorescence microscopy (Fig. 3), suggesting that the EMF could invade the epidermal cells within 2 weeks and colonize the hair roots. Two weeks after inoculation, several epidermal cells of the V. uliginosum roots were infected by C. ericae, and larger hyphal coils could be observed; however, fewer epidermal cells were infected by Sordariomycetes sp., which formed smaller hyphal coils. This suggest that C. ericae has a more rapid invasion and hyphal coil-forming process than Sordariomycetes sp.

Analysis of EMF colonization by in situ PCR

Total nucleic acids extracted from the fungal hyphae were used as the template. A digoxigenin-labeled DNA probe was prepared by PCR using the ITS1/ITS4 primer pair, and the predicted products of the labeled probe were obtained.

The probe was tested via hybridization to membrane-blotted nucleic acids according to standard methods, following which the hybridized probe was immunodetected with an anti-digoxigenin antibody and visualized with the colorimetric substrates nitro-blue tetrazolium chloride (NBT)/5-bromo-4-chloro-3′-indolyphosphate p-toluidine salt (BCIP). Based on the digoxigenin-labeled DNA probe and hybridization system in the membrane, we developed the in situ PCR system.

Frozen sections were prepared from the micropropagated seedlings of V. uliginosum inoculated by EMF, and the fungal colonization of V. uliginosum roots was investigated by in situ PCR. The NBT/BCIP caused a redox reaction that formed an Alcian blue precipitate, which indicated the fungal location in the tissue. In general, there were several purple Alcian blue precipitate signals in the sections from the inoculated samples, whereas Alcian blue precipitate did not appear on the uninoculated samples (the negative controls) (Fig. 4). EMF could be detected efficiently in the sections of hair roots from V. uliginosum 2 weeks after inoculation. As observed in the GFP-expressing analysis, the distribution of positive signals was non-uniform.

Fig. 4
figure 4

Analysis of EMF colonization by in situ PCR. Bar is 20 μm. a negative control; b longitudinal sections of the roots of V. uliginosum 2 weeks after inoculation of EMF, indicating colonization. Positive signals are labeled with arrowheads

Full size image

Discussion

Mycorrhizal formation involves a series of complex processes from constant mutual antagonisms to balance between fungus and host [21]. Most studies have focused on the colonization processes of AM fungi [22,23,24]. In contrast, there have been fewer studies on the processes of EMF colonization [8]. During the colonization processes of EMF, a symbiotic interaction may occur before actual fungus-root contact [25]. The metabolites, which are released into the rhizosphere, may trigger spore germination and regulate the tropism of the hyphae in the host tissues [26]. EMF must penetrate the cell wall of the host during the establishment of the symbiosis, and the process is likely to be enzyme-mediated [27]. In most cases, EMF hyphae penetrate the epidermal cell via a single penetration point [2]. In the present study, the invading EMF proliferated to produce numerous fungal hyphae, which occupied most of the volume of the plant cell (Fig. 1), finally, EMF formed a mature colonization. There have been fewer studies on the period from the earliest infection process to the establishment of the mature symbiosis between EMF and ericaceous plants [28]. Following inoculation of the hair roots of Rhododendron ponticum by EMF, colonization was detected in irradiated soil after 3 weeks [2]. Using in situ PCR and GFP expression, in the present study we found that EMF colonization could be detected in the hair roots of V. uliginosum 2 weeks after inoculation. Different fungi–host study systems may have important effects on the colonization time of EMF.

In situ PCR, which is based on PCR performed on fixed, whole cells, or sections, is a powerful tool for detecting the low-copy molecules [16]. In the in situ PCR system, fixed cells is the crucial reaction unit, which is considered as “semi-permeable amplifying bags” via proteinase K pretreatment [29], and fixed cells permit the entry of PCR components into the cytoplasm. The PCR product within the cell can be ultimately visualized by the color development system based on the labelled molecular-antibody-enzyme conjugate [17]. In situ PCR is often used in animal and medical studies, but fewer applications have been reported in plants [30, 31]. Currently, two main patterns, direct and indirect, have been developed for in situ PCR [31]. In the direct in situ PCR, some labeled nucleotides are directly incorporated into the PCR products, whereas for the indirect in situ PCR, the PCR products are detected by in situ hybridization using a labeled probe [32, 33]. In this study, we chose indirect in situ PCR, which is less convenient when there are more steps than the direct in situ PCR. However, indirect in situ PCR has good specificity and high amplification efficiency [34, 35]. In berry plants, secondary metabolites may have direct inhibitory effects on PCR amplification, and therefore the results of PCR were often inconsistent [36, 37]. The high sensitivity of the indirect in situ PCR may reduce the inhibitory effects on PCR amplification. In addition, the secondary metabolites are possibly swept out during the tissue preparation and pre-treatment processes. Generally, several conditions need to be optimized for new tissue when using in situ PCR due to different cell compositions, and the optimization process can be time-consuming [31, 32]. In addition, we used the universal primer pair ITS1/ITS4 to prepare the probe, and thus were unable to distinguish between the EMF and other fungi. The latter can be solved by designing a specific primer pair for a species of EMF.

This research represents the first attempt to detect ericoid mycorrhizal colonization using in situ PCR, and the EMF could be detected effectively in the sections by in situ PCR. Although many experimental procedures need be performed, in situ PCR is an excellent method for detecting EMF colonization.

Martino et al. [13] first reported an EMF transformant of Oidiodendron expressing the gfp gene. In this study, we reported the successful and stable transformation of two different ericoid mycorrhizal strains of C. ericae and Sordariomycetes sp. by A. tumefaciens-mediated transformation. Although the processes of transformation and expression of the gfp gene are laborious and time-consuming, the characterization of EMF colonization could be efficiently observed on the basis of a single operation using fluorescence microscopy in tissue sections without requiring cofactors or substrates. The main advantage of using fluorescent markers to detect EMF-plant associations over traditional techniques relies on the fact that fluorescent proteins do not require preparatory steps, which might affect the structure of the living cells [38]. As the GFP-tagged transformants maintain their mycorrhizal competence, it is more advantageous to study the early stages of symbiosis [13].

GFP tagging of a specific fungal strain depends on both the development of an efficient transformation protocol and the stable expression of the gfp gene in the fungus under natural environmental conditions [39]. However, unlike AM fungi (Glomeromycota), EMF are not monophyletic and contain functionally diverse groups [1, 2]. Therefore, for several specific EMF groups, it may be difficult to transform the gfp gene into the cells. In addition, the weak, interfering autofluorescence caused by the root tissues of V. uliginosum is undesirable. Application of laser scanning confocal microscopy is likely to partially avoid the autofluorescence of the root tissues [40]. In brief, the GFP-expressing method still constitutes an excellent system for detecting the colonization of EMF, but it is dependent on the successful transformation and expression of the gfp gene.

Conclusions

We detected the colonization of EMF using a GFP expression method and in situ PCR in this study. Both in situ PCR and GFP expression indicated that EMF could colonize hair roots of V. uliginosum 2 weeks after inoculation. This research represents the first attempt to detect ericoid mycorrhizal colonization using in situ PCR. Both in situ PCR and GFP expression can be developed as new tools to study the interactions of EMF both with ericaceous plants and with the environment. Using specific primers corresponding to different fungi, the localization and proliferation characteristics of different fungi within hair root can be detected by in situ PCR. Similarly, the niche of different fungi can be analyzed using different fluorescent reporter proteins. Overall, in situ PCR and GFP expression will have important potential applications in mycorrhizal studies.

Methods

Plant materials and fungal strains

Root samples of Vaccinium uliginosum were collected from the Greater Khingan Mountains. To minimize damage to the roots, whole plants were removed with intact soil cores, placed into containers, and transported back to the laboratory. Strain 103 of C. ericae and strain 105 of Sordariomycetes sp. were isolated from the hair roots of V. uliginosum, and the strains were confirmed as EMF via resynthesis trials.

Scanning electron microscopy

Hair root tissues of V. uliginosum inoculated with strain 103 of C. ericae were fixed with 2.5% glutaraldehyde for 6 h at 4 °C and sequentially dehydrated for 10 min in 30, 50, 70, and 90% ethanol solutions, and then twice for 20 min in 100% ethanol. The samples were freeze-dried and gold-coated by sputtering. Finally, the samples were observed with a field emission scanning electron microscope (JSM-7500F, JEOL Ltd., Japan).

Agrobacterium tumefaciens-mediated transformation to obtain GFP-expressing fungi

The plasmid vector pCT74, which contains the gfp gene driven by the ToxA promoter and hygromycin resistance gene expression cassette, was obtained from Bo Liu, Fujian Provincial Academy of Agricultural Sciences of China. The region containing the ToxA promoter, gfp gene, and nos-terminator of the vector pCT74 was amplified by PCR, and then the specific fragment was cloned into the multiple cloning site of the vector pCAMBIA1300. The cloned product was digested with restriction enzymes to remove the region of the hygromycin resistance gene expression cassette and CaMV 35S promoter. The digested product containing the pCAMBIA1300 backbone, ToxA promoter, gfp gene, and nos-terminator was ligated with the hygromycin resistance gene expression cassette of the vector pCT74, which was obtained by restriction enzyme digestion of the vector pCT74, ultimately yielding the binary vector pXBTCEH-GFP. PCR, molecular cloning, and digestion were conducted according to Sambrook and Russell [41]. A schematic diagram for the construction of the vector pXBTCEH-GFP is presented in Fig. 5.

Fig. 5
figure 5

Schematic diagram for construction of the vector pXBTCEH-GFP based on the elements of vector pCT74 and pcAMBIA1300. MCS, multiple cloning site; HygR cassette, hygromycin resistance gene expression cassette

Full size image

Transformation was conducted as previously described by Martino et al. [13]. Briefly, A. tumefaciens strain EHA105/pXBTCEH-GFP was grown on YEP (yeast extract peptone) plates containing 50 µg/mL kanamycin. One colony was selected from the plate and grown in 100 mL LB liquid medium containing 50 µg/mL kanamycin at 25 °C 150 rpm for 21 h. The entire contents of the flask were collected and re-suspended in the induction medium containing 200 µM acetosyringone [13]. The suspension was then diluted to obtain an OD600 range from 0.15 to 0.20 and incubated at 25 °C and 130 rpm for 6 h (until OD600 reached 0.6–0.8). The mycelium suspension of strain 103 of C. ericae or strain 105 of Sordariomycetes sp. was prepared by filtering the mycelium from a shaking (120 rpm) culture grown at 25 °C. After 6 h, the bacterial suspension was mixed with the mycelial suspension (1:1, v/v). The content was evenly distributed onto Petri plates containing the co-cultivation medium and covered with sterilized cellulose dialysis membrane squares. Two days after plating, fungal transformants were selected by transferring the cellulose membranes to plates containing the selective medium (Czapek dox agar 1%) supplemented with 100 µg/mL hygromycin B and 200 µM cefotaxime, and incubated at 25 °C. Each transformant was subsequently transferred to Czapek dox medium containing 100 µg/mL hygromycin B.

The fungal transformants were further verified according to Silva et al. [42]. Total DNA from the liquid-grown mycelia of the transformants and wild-type strains was extracted using CTAB methods [43]. The gfp gene was detected by PCR using primers GFP-F (GACGTAAACGGCCACAAGTT) and GFP-R (CCTCCTTGAAGTCGATGCCC), which amplified a 330 bp sequence. Fluorescent emissions of the mycelia of putative transformants were examined with a fluorescence microscope (TE2000, Nikon, Japan) and images were recorded using NIS-Elements software (Nikon). The fluorescence stability of the transformants was detected by sub-culturing five times.

GFP expression by fungal transformants was also used in the V. uliginosum roots. Sterile micropropagated seedlings were transplanted into culture bottles containing the sterilized soil mixture (peat moss/vermiculite [1:1, v/v], which had been autoclaved twice for 40 min), and woody plant medium (Yutong, Shanghai, China), and then the inoculated transformants expressing GFP were added. The seedlings were maintained in a growth chamber under a 22 °C, 16 h/8 h day/night cycle, and irradiation of 70 µmol m−2 s−1. Infection and fluorescence patterns inside the roots were evaluated by microscopy.

In situ PCR

Hair root tissues of V. uliginosum inoculated with EMF were embedded in optimum cutting temperature compounds (OTC) and then frozen for 30 s in liquid nitrogen. Sections (thickness of 10 µm) were cut from each OTC-embedded sample on a freezing rotary microtome (CM1900, Leica, Germany). The sections were then collected with a paintbrush on Superfrost plus microscope slides (Thermo Fisher Scientific, Waltham, USA). Fixation of the tissue, dehydration, treatment of proteinase, in situ PCR reaction, and detection of hybridization were conducted according to Yang et al. [14] with minor modifications. During the proteinase treatment, digestion was performed for 5 min at 37 °C using 6 µg/mL proteinase K. The digoxigenin-labeled reaction was performed using a DIG DNA Labeling and Detection Kit (Roche, Germany) with the primer pair ITS1/ITS4 according to the manufacturer’s instructions. The sections were then observed under a microscope (TE2000, Nikon, Japan).

Availability of data and materials

All data generated or analysed during this study are included in this published article.

References

  1. Leopold DR. Ericoid fungal diversity: challenges and opportunities for mycorrhizal research. Fungal Ecol. 2016;24:114–23.

    Article  Google Scholar 

  2. Smith SE, Read D. Ericoid mycorrhizas. In: Smith SE, Read D, editors. Mycorrhizal symbiosis. 3rd ed. London: Academic Press; 2008. p. 389–418.

    Chapter  Google Scholar 

  3. Vrålstad T. Are ericoid and ectomycorrhizal fungi part of a common guild? New Phytol. 2004;164(1):7–10.

    Article  PubMed  Google Scholar 

  4. Cairney JWG, Meharg AA. Ericoid mycorrhiza: a partnership that exploits harsh edaphic conditions. Eur J Soil Sci. 2003;54(4):735–40.

    Article  Google Scholar 

  5. Baba T, Hirose D, Sasaki N, Watanabe N, Kobayashi N, Kurashige Y, et al. Mycorrhizal formation and diversity of endophytic fungi in hair roots of Vaccinium oldhamii Miq, Japan. Microbes Environ. 2016;31(2):186–9.

    Article  PubMed  PubMed Central  Google Scholar 

  6. Gadkar V, Rillig MC. Evaluation of loop-mediated isothermal amplification (LAMP) to rapidly detect arbuscular mycorrhizal fungi. Soil Biol Biochem. 2008;40(2):540–3.

    Article  CAS  Google Scholar 

  7. Yang H, Zhao X, Liu C, Bai L, Zhao M, Li L. Diversity and characteristics of colonization of root-associated fungi of Vaccinium uliginosum. Sci Rep. 2018;8(1):15283.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  8. Perotto S, Peretto R, Faccio A, Schubert A, Bonfante P, Varma A. Ericoid mycorrhizal fungi: cellular and molecular bases of their interactions with the host plant. Can J Bot. 1995;73:557–68.

    Article  Google Scholar 

  9. Lukešová T, Kohout P, Větrovský T, Vohník M. The potential of dark septate endophytes to form root symbioses with ectomycorrhizal and ericoid mycorrhizal middle European forest plants. PLoS ONE. 2015;10(4):e0124752.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  10. Vagi P, Knapp DG, Kosa A, Seress D, Horvath AN, Kovacs GM. Simultaneous specific in planta visualization of root-colonizing fungi using fluorescence in situ hybridization (FISH). Mycorrhiza. 2014;24(4):259–66.

    Article  CAS  PubMed  Google Scholar 

  11. Villarreal-Ruiz L, Neri-Luna C, Anderson IC, Alexander IJ. In vitro interactions between ectomycorrhizal fungi and ericaceous plants. Symbiosis. 2012;56(2):67–75.

    Article  CAS  Google Scholar 

  12. Vohník M, Albrechtová J. The co-occurrence and morphological continuum between ericoid mycorrhiza and dark septate endophytes in roots of six European Rhododendron Species. Folia Geobotanica. 2011;46(4):373–86.

    Article  Google Scholar 

  13. Martino E, Murat C, Vallino M, Bena A, Perotto S, Spanu P. Imaging mycorrhizal fungal transformants that express EGFP during ericoid endosymbiosis. Curr Genetics. 2007;52(2):65–75.

    Article  CAS  Google Scholar 

  14. Yang H, Xin Z, Lili L, Zhiwei Q. localization of a plant virus combining in situ reverse transcription-polymerase chain reaction with a light microscope. Adv Sci Lett. 2011;4(4):1536–40.

    Article  CAS  Google Scholar 

  15. Hodson RE, Dustman WA, Garg RP, Moran MA. In situ PCR for visualization of microscale distribution of specific genes and gene products in prokaryotic communities. Appl Environ Microbiol. 1995;61(11):4074–82.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Matsuda Y, Toyoda H, Kurita A, Ouchi S. In situ PCR technique based on pricking microinjection for cDNA cloning in single cells of barley coleoptile and powdery mildew pathogen. Plant Cell Rep. 1997;16(9):612–8.

    Article  CAS  PubMed  Google Scholar 

  17. Przybecki Z, Siedlecka E, Filipecki M, Urbanczyk-Wochniak E. In situ reverse transcription pcr on plant tissues. In: Pellestor F, editor. PRINS and in situ pcr protocols. Totowa: Humana Press; 2006. p. 181–98.

    Chapter  Google Scholar 

  18. Tsien RY. The green fluorescent protein. Annu Rev Biochem. 1998;67:509–44.

    Article  CAS  PubMed  Google Scholar 

  19. Lorang JM, Tuori RP, Martinez JP, Sawyer TL, Redman RS, Rollins JA, et al. Green fluorescent protein is lighting up fungal biology. Appl Environ Microbiol. 2001;67(5):1987–94.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Hartmann M, Voß S, Requena N. Host-induced gene silencing of arbuscular mycorrhizal fungal genes via Agrobacterium rhizogenes-mediated root transformation in Medicago truncatula. In: Ferrol N, Lanfranco L, editors. Arbuscular mycorrhizal fungi: methods and protocols. New York: Springer US; 2020. p. 239–48.

    Chapter  Google Scholar 

  21. Gadkar V, David-Schwartz R, Kunik T, Kapulnik Y. Arbuscular mycorrhizal fungal colonization. Factors involved in host recognition. Plant Physiol. 2001;127(4):1493.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Genre A, Chabaud M, Faccio A, Barker DG, Bonfante P. Prepenetration apparatus assembly precedes and predicts the colonization patterns of arbuscular mycorrhizal fungi within the root cortex of both medicago truncatula and Daucus carota. Plant Cell. 2008;20(5):1407.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Bennett AE, Macrae AM, Moore BD, Caul S, Johnson SN. Early root herbivory impairs arbuscular mycorrhizal fungal colonization and shifts defence allocation in establishing Plantago lanceolata. PLoS ONE. 2013;8(6):e66053.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Parniske M. Arbuscular mycorrhiza: the mother of plant root endosymbioses. Nat Rev Microbiol. 2008;6:763.

    Article  CAS  PubMed  Google Scholar 

  25. Cairney JWG, Burke RM. Fungal enzymes degrading plant cell walls: their possible significance in the ectomycorrhizal symbiosis. Mycol Res. 1994;98(12):1345–56.

    Article  CAS  Google Scholar 

  26. Martin F, Duplessis S, Ditengou F, Lagrange H, Voiblet C, Lapeyrie F. Developmental cross talking in the ectomycorrhizal symbiosis: signals and communication genes. New Phytol. 2001;151(1):145–54.

    Article  CAS  PubMed  Google Scholar 

  27. Burke RM, Cairney JWG. Purification and characterization of a beta-1,4-endoxylanase from the ericoid mycorrhizal fungus Hymenoscyphus ericae. New Phytol. 1997;135(2):345–52.

    Article  CAS  Google Scholar 

  28. Duddridge J, Read DJ. An ultrastructural analysis of the development of mycorrhizas in Rhododendron ponticum. Can J Bot. 1982;60(11):2345–56.

    Article  Google Scholar 

  29. O’Leary JJ, Chetty R, Graham AK, Mc GEEJOD. In situ PCR: pathologist’s dream or nightmare? J Pathol. 1999;178(1):11–20.

    Article  Google Scholar 

  30. Pesquet E, Barbier O, Ranocha P, Jauneau A, Goffner D. Multiple gene detection by in situ RT-PCR in isolated plant cells and tissues. Plant J. 2004;39(6):947–59.

    Article  CAS  PubMed  Google Scholar 

  31. Athman A, Tanz SK, Conn VM, Jordans C, Mayo GM, Ng WW, et al. Protocol: a fast and simple in situ PCR method for localising gene expression in plant tissue. Plant Methods. 2014;10:29.

    Article  PubMed  PubMed Central  Google Scholar 

  32. Bagasra O. Protocols for the in situ PCR-amplification and detection of mRNA and DNA sequences. Nat Protoc. 2007;2(11):2782–95.

    Article  CAS  PubMed  Google Scholar 

  33. Hishikawa Y, An S, Yamamoto-Fukuda T, Shibata Y, Koji T. Improvement of in situ PCR by optimization of PCR cycle number and proteinase k concentration: localization of x chromosome-linked phosphoglycerate kinase-1 gene in mouse reproductive organs. Acta Histochem Cytochem. 2009;42(2):15–21.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Lin CM, Jeng CR, Hsiao SH, Chang CC, Liu CH, Tsai YC, et al. Development and evaluation of an indirect in situ polymerase chain reaction for the detection of porcine circovirus type 2 in formalin-fixed and paraffin-embedded tissue specimens. Vet Microbiol. 2009;138(3):225–34.

    Article  CAS  PubMed  Google Scholar 

  35. Hully JR. In situ PCR. In: Innis MA, Gelfand DH, Sninsky JJ, editors. PCR applications. San Diego: Academic Press; 1999. p. 169–94.

    Chapter  Google Scholar 

  36. Posthuma KI, Adams AN, Hong Y, Kirby MJ. Detection of Strawberry crinkle virus in plants and aphids by RT-PCR using conserved L gene sequences. Plant Pathol. 2002;51(3):266–74.

    Article  CAS  Google Scholar 

  37. Thompson JR, Wetzel S, Klerks MM, Vašková D, Schoen CD, Špak J, et al. Multiplex RT-PCR detection of four aphid-borne strawberry viruses in Fragaria spp. in combination with a plant mRNA specific internal control. J Virol Methods. 2003;111(2):85–93.

    Article  CAS  PubMed  Google Scholar 

  38. Palencia ER, Glenn AE, Hinton DM, Bacon CW. Constitutive expression of fluorescent protein by Aspergillus var. niger and Aspergillus carbonarius to monitor fungal colonization in maize plants. J Microbiol Methods. 2013;94(3):381–9.

    Article  CAS  PubMed  Google Scholar 

  39. Crespo-Sempere A, López-Pérez M, Martínez-Culebras PV, González-Candelas L. Development of a green fluorescent tagged strain of Aspergillus carbonarius to monitor fungal colonization in grapes. Int J Food Microbiol. 2011;148(2):135–40.

    Article  CAS  PubMed  Google Scholar 

  40. Hanson MR, Köhler RH. GFP imaging: methodology and application to investigate cellular compartmentation in plants. J Exp Bot. 2001;52(356):529–39.

    Article  CAS  PubMed  Google Scholar 

  41. Sambrook J, Russell DW. Molecular cloning: a laboratory manual. Cold Spring Harbor: Cold Spring Harbor Laboratory; 2001.

    Google Scholar 

  42. Silva APD, Bolton MD, Nelson BD. Transformation of Sclerotinia sclerotiorum with the green fluorescent protein gene and fluorescence of hyphae in four inoculated hosts. Plant Pathol. 2009;58(3):487–96.

    Article  Google Scholar 

  43. Yang H, Zhang Z, Dai H, Li H. Detection of strawberry mottle virus by RT-PCR. Acta Hort. 2007;764:127–36.

    Article  CAS  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

The study was supported by the National Natural Science Foundation of China (31670605, 31971694, 31300573), and the Fundamental Research Funds for the Central Universities (2572017DA07).

Author information

Authors and Affiliations

  1. College of Life Sciences, Northeast Forestry University, Harbin, 150040, China

    Hongyi Yang, Xingyu Zhao & Jie Zhang

  2. Key Laboratory of Saline-alkali Vegetation Ecology Restoration (Northeast Forestry University), Ministry of Education, Harbin, 150040, China

    Hongyi Yang & Jie Zhang

  3. Institute of Forestry Science of Heilongjiang Province, Harbin, 150081, China

    Lili Li

Authors
  1. Hongyi Yang
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Xingyu Zhao
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Lili Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Jie Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

LL and JZ: contributed to the design of the work; LL and HY were major contributors in writing the manuscript; HY and XZ performed the experiments. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Lili Li or Jie Zhang.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Yang, H., Zhao, X., Li, L. et al. Detecting the colonization of ericoid mycorrhizal fungi in Vaccinium uliginosum using in situ polymerase chain reaction and green fluorescent protein. Plant Methods 16, 102 (2020). https://doi.org/10.1186/s13007-020-00645-x

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s13007-020-00645-x

Keywords

Plant Methods

ISSN: 1746-4811