Skip to main content

Table 1 List of primers for genotyping analysis of dandelion

From: Genetic transformation technologies for the common dandelion, Taraxacum officinale

Primer name The sequence (5′-3′) Length of product (bp)
ACTIN-F CGTCGATCTCAAGGATGTTGTC 120
ACTIN-R GGAGCTTTGAGAAGAACCAACG  
YFP-F ATGGTGAGCAAGGGCG 300
YFP-R TTGTACAGCTCGTCCATGC  
BASTA-F AAACCCACGTCATGCCAGTT 343
BASTA-R AAGCACGGTCAACTTCCGTA