Skip to main content

Table 2 Primer sequences used for PCR amplification of CRISPR/Cas9 target sites of the apple MYB10 locus

From: CRISPR-Cas9 enrichment and long read sequencing for fine mapping in plants

Name crRNA Sequence 5′-3′ Tm %GC Start position End position
Chr9_35542587_F crRNA_RF_1, crRNA_RF_2 AACAAGATGATGACGACGTG 56.2 45 35542587 35542606
Chr9_35542966_R crRNA_RF_1, crRNA_RF_2 GATGCACGAACTGATACTGT 55.6 45 35542947 35542966
Chr9_35550584_F crRNA_RF_3 CCCTGTATGCGAAAGACAAT 55.8 45 35550584 35550603
Chr9_35550962_R crRNA_RF_3 AAAAGACCACATGCATGCTG 57.3 45 35550943 35550962
Chr9_35551563_F crRNA_RF_4 TGATTGAATGTCTCCACCA 53.6 42.1 35551563 35551581
Chr9_35552158_R crRNA_RF_4 CACATGTGAGAGAGATTTGC 54.4 45 35552158 35552177
  1. crRNA CRISPR RNA, Tm melting temperature (°C), %GC GC content, start and end positions are in base pairs on apple chromosome 9 (‘Golden Delicious’ double haploid GDDH13v1.1) [34].