CRISPR-Cas9 enrichment and long read sequencing for fine mapping in plants

Table 2 Primer sequences used for PCR amplification of CRISPR/Cas9 target sites of the apple MYB10 locus

Name	crRNA	Sequence 5′-3′	Tm	%GC	Start position	End position
Chr9_35542587_F	crRNA_RF_1, crRNA_RF_2	AACAAGATGATGACGACGTG	56.2	45	35542587	35542606
Chr9_35542966_R	crRNA_RF_1, crRNA_RF_2	GATGCACGAACTGATACTGT	55.6	45	35542947	35542966
Chr9_35550584_F	crRNA_RF_3	CCCTGTATGCGAAAGACAAT	55.8	45	35550584	35550603
Chr9_35550962_R	crRNA_RF_3	AAAAGACCACATGCATGCTG	57.3	45	35550943	35550962
Chr9_35551563_F	crRNA_RF_4	TGATTGAATGTCTCCACCA	53.6	42.1	35551563	35551581
Chr9_35552158_R	crRNA_RF_4	CACATGTGAGAGAGATTTGC	54.4	45	35552158	35552177

crRNA CRISPR RNA, Tm melting temperature (°C), %GC GC content, start and end positions are in base pairs on apple chromosome 9 (‘Golden Delicious’ double haploid GDDH13v1.1) [34].

ISSN: 1746-4811