Skip to main content

Table 1 Primers designed for quantitative real-time PCR

From: Development of a DNA-based real-time PCR assay for the quantification of Colletotrichum camelliae growth in tea (Camellia sinensis)

Primer namesReference geneGenBank Accession NumberPrimer sequence (5′-3′)
forward/reverse
Product
Tm (°C)
Amplicon size (bp)GC (%)qRT-PCR efficiency (%)
S37/S38Cs18S rDNA1AY563528.1GACTCCGCTGGCACCTTAT/GCCCTTCCGTCAATTCCT83.71674897.6–98.1
S572/S573GAPDHKJ954782CCCGCATCTGGTAGACAAGA/TGATAGCATGTGTCCCTCCG81.0825092.0–98.8
S576/S577ITSKJ955081AAAGGTAGTGGCGGACCCT/CCCAGTGCGAGACGTAAAGT82.5625896.0–97.6
  1. Tm melting temperature, GC (%) guanine-cytosine percentages