Skip to main content

Table 1 Comprehensive details of 11 candidate reference genes used for normalization

From: Reference genes identification for normalization of qPCR under multiple stresses in Hordeum brevisubulatum

Gene symbol Primers (5′–3′)
Forward/reverse
Length (bp) Tm (°C) PCR efficiency Regression coefficient (R2)
ACT TGCATGGTGTTCTCTGCACT
GCCAAAGCGTGATACTGTCG
121 60 0.92 0.997
ADP CAAGAGATAGTATGTGTGCGTATG
AACCACGGCACAGAAATACTGAT
115 60 1.03 0.997
CYP2 CCTGTCGTGTCGTCGGTCTAAA
ACGCAGATCCAGCAGCCTAAAG
151 60 0.96 0.991
EF- CAACAACGCCCAGGAACAAC
AGAAGAAGGACCCCACTGGT
159 60 0.94 0.994
GAPDH AGCTGCACCACTAACTGCCT
AACAGTGGTCATCAAACCCTCAAT
84 60 0.96 0.997
HSP90 CAGCACCTCCTTGATGACCTT
GGAGTTTGAGGGCAAGAAGC
136 60 0.97 0.997
TUBα CGAGATGCACTCCCTCATGG
CGTCTTCGTACTCGCCTCTC
128 60 1.15 1.000
TUBβ6 CCCGACGAGAACGCTTCAAT
CTGGATGTGCAGGATCTCCC
74 60 0.89 0.996
UBI TGGATGTTGTAGTCGGCGAG
ACGTCAAGGCCAAGATCCAG
112 60 0.90 0.996
18SrRNA-1 CCCGCTTCTAAGTCGGTGTT
CAACAGAAGCGCGATACAGC
99 60 0.88 0.997
18SrRNA-3 TTTCGTGAGGGCCTGCTTAG
GACTCACAGAACATGGGGCA
83 60 0.97 0.997
  1. The correlation coefficients (R2) and slope values were obtained from the standard regression curves and the PCR amplification efficiencies (E) were calculated according to the following equation: E = (10−1/slope − 1)