Skip to main content

Advertisement

Table 1 List of primer sequences used in this study

From: Harnessing anthocyanin-rich fruit: a visible reporter for tracing virus-induced gene silencing in pepper fruit

Primer Sequence (5′–3′)
VIGS construct  
CS_lic_F CGACGACAAGACCCTGAGAAGGGAAACTGCCATTTGA
CS_An2_R CTTTGTCTAGTG CCTTGCCCAGCTTTGTAATCTT
GFP_lic_F CGACGACAAGACCCTCACGGCAGACAAACAAAAGA
GFP_An2_R CTTTGTCTAGTG AAAGGGCAGATTGTGTGGAC
An2_F CACTAGACAAAGACGAACGCGAC
An2_lic_R GAGGAGAAGAGCCCTCAGAAAAGTCATCCCAACCATCAC
PDS_lic_F CGACGACAAGACCCTCTTGCAAAGATCCCCTGTAG
PDS_An2_R CTTTGTCTAGTGCACTTGTTTCTGCCAACTTC
Sequencing  
TRV2_seq_F CTGTTTGAGGGAAAAGTAG
TRV2_seq_R CAAAAGACTTACCGATCAATC
qRT-PCR  
CS_F TTCCCATATAGCCCACTTGC 
CS_R ACTACAAGCAAATTACCACCTTC
PDS_F AGCAAAGCAAAAATATTGAAGTA
PDS_R GCTTTCCTGATAAGACAGC
An2_F GGAGAAGGAAAGTGGCATCTTGT
An2_R CACCTCTCTTTATATGCGGCCTT
CaActin_F ATGGCAGATGAAGATATTCAAC
CaActin_R ACTAGGAAAAACAGCCCTTGGT