Skip to main content

Table 1 List of TALEN and RGEN target site sequences and experiments used

From: A simple test for the cleavage activity of customized endonucleases in plants

Construct Target sequence Species Approach (constructs)
pTARGET-gfp1 TGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAAGT Tobacco RGENt, st (pSI24)
TALENt, st (pSP10, pSP11)
Barley TALENt, st (pGH297, pGH400)
pTARGET-gfp2 GTCTTTGCTCAGGGCGGACTGGG Barley RGENt (pSH92)
MLO pair #1 TGGTGCTCGTGTCCGTCCTCATGGAACACGGCCTCCACAAGCTCGGCCATGTA Tobacco/barley TALENt (p110/111)
MLO pair #2 TCCTCATGGAACACGGCCTCCACAAGCTCGGCCATGTAAGTCCCGTTACCCTA TALENt (p112/113)
MLO pair #3 TGGAACACGGCCTCCACAAGCTCGGCCATGTAAGTCCCGTTACCCTAGCTCAA TALENt (p114/115)
MLO pair #4 TGCTGGCTTTGTATGCAGATGGGATCAAACATGAAGAGGTCCATCTTCGACGA TALENt (p124/125)
MLO pair #5 TGGCTTTGTATGCAGATGGGATCAAACATGAAGAGGTCCATCTTCGACGAGCA TALENt (p126/127)
pTARGET-MLO GCTGGAACACGGCCTCCACAAGCTCGGCCATGTAAGTCCCGTTACCCTAGCTCA Barley TALENt, st (p114/115)
  1. t transient, st stable transgenic plants