Skip to main content

Table 3 Oligonucleotides used

From: TETX: a novel nuclear selection marker for Chlamydomonas reinhardtii transformation

Name Sequence 5′-3′
aph8F CGTGCACTGCGGGGTCGGT
aph8R CCGCCCCATCCCACCCGC
ble1F CCGGGTCGCGCAGGGC
ble1R GCGCCGTTCCGGTGCTCA
tetXhF TCTCGAGATGACCATGCGCATCGACACCGA
tetBaR TGGATCCTCACACGTTCAGCAGCAGCTGCTG
  1. Listing of oligonucleotides used in this work. Bases in bold indicate recognition sites for restrictions enzymes and accessory bases used for cloning purposes.