Skip to main content

Table 1 Name and sequence (5’ – 3’) of primers used for the experiments

From: Development of a rapid and inexpensive method to reveal natural antisense transcripts

Primer name Primer sequence
OeSLG_full-length_FOR ATGGAGAAATCGATTAAAGATATA
OeSLG_full-length_REV CTAAGAAGAAGCCATTCTAATGTAAATA
OeSLG_full-length_5'-tag_FOR GGCAGTATCGTGAATTCGATGCATGGAGAAATCGATTAAAGATATA
OeSLG_full-length_5'-tag_REV GGCAGTATCGTGAATTCGATGCCTAAGAAGAAGCCATTCTAATGTAAATA
OeSLG_internal_FOR ATTACCAGACGCACAATATTCCACG
OeSLG_internal_REV TGCAGCATTCCAACCGAAGTTC
OeEF_FOR TGCACAGTTATTGATGCTCCA
OeEF_REV GGGCTCCTGAATCTGGTCAA
OeEF_5'-tag_FOR GGCAGTATCGTGAATTCGATGCTGCACAGTTATTGATGCTCCA
primer_TAG GGCAGTATCGTGAATTCGATGC