Skip to main content

Advertisement

Table 1 Primer sequences and amplification efficiencies

From: Rapid quantification of plant-powdery mildew interactions by qPCR and conidiospore counts

Primer Sequence Target Accession# Amplicon in bp Efficiency in%
R189 GAATCCACCCATACCACCAG RNA-binding (RRM/RBD/RNP motifs) family protein At3g21215 114 95
R192 GAGGAGGAGGATGGTGATGA
R243 AAGCACCTCCTGCTGTTCAT Glyceraldehyde-3-phosphate dehydrogenase of plastid 2 At1g16300 125 91
R244 CTTTCCACTGCTCCTTGACC
R193 TCGCCGCTATATTTGGAGTC Plasma membrane ATPase 1 Go_V1_Contig3757 90 90
R194 CTGGGTCAGATGGTTCACCT
R263 TCTTGGTGGCACGAATGAC GDSL-like lipase Go_V1_Contig76 92 100
R264 AGTGCGAGAGTGGGACAGAC