Skip to main content

Advertisement

Table 1 miRNA, primer and probe sequences

From: Protocol: a highly sensitive RT-PCR method for detection and quantification of microRNAs

miR156 miRNA sequence UGACAGAAGAGAGUGAGCAC
  Antisense probe GTGCTCACTCTCTTCTGTCA
  Sense probe TGACAGAAGAGAGTGAGCAC
  RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTGCTC
  Forward primer GCGGCGGTGACAGAAGAGAGT
  UPL RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCA ACGTGCTC
miR156RC RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGACAG
  Forward primer GCGGCGTGTGCTCACTCTCT
miR159 miRNA sequence UUUGGAUUGAAGGGAGCUCUA
  Antisense probe TAGAGCTCCCTTCAATCCAAA
  Sense probe TTTGGATTGAAGGGAGCTCTA
  RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGAGC
  Forward primer CGGCGGTTTGGATTGAAGGGA
  UPL RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCA ACTAGAGC
miR159RC RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTTGGA
  Forward primer CGGCGGTAGAGCTCCCTTCAA
miR167 miRNA sequence UGAAGCUGCCAGCAUGAUCUA
  Antisense probe TAGATCATGCTGGCAGCTTCA
  Sense probe TGAAGCTGCCAGCATGATCTA
  RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGATC
  Forward primer TCGCGTGAAGCTGCCAGCAT
  UPL RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCA ACTAGATC
miR167RC RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGAAGC
  Forward primer GGCGGTAGATCATGCTGGCA
miR171 miRNA sequence UGAUUGAGCCGCGCCAAUAUC
  Antisense probe GATATTGGCGCGGCTCAATCA
  RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGATATT
  Forward primer TTCCTTGATTGAGCCGCGCC
  UPL RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCA ACGATATT
miR166 miRNA sequence UCGGACCAGGCUUCAUUCCCC
  RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGGGAA
  Forward primer TCGCTTCGGACCAGGCTTCA
  UPL RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCA ACGGGGAA
Universal Reverse primer GTGCAGGGTCCGAGGT
CmRBS Forward primer ATGGCTTCCATCGTCTCATCCGCC
  Reverse primer TTGTCGAAGCCAATGACTCTGATGAA
CmPP16 Forward primer GTGGTAAAGGACTTCAAGCCCACGACC
  Reverse primer ATGGGTTTGAAGAAGCCAAGCCACTTA
  1. UPL probe #21 reverse complement sequence is highlighted in bold.