Skip to main content

Table 2 Primer sequences used in ChIP-qPCR assays

From: A native chromatin immunoprecipitation (ChIP) protocol for studying histone modifications in strawberry fruits

Primer names Gene ID Primer sequence (5′ → 3′)
Gypsy 1_F FvH4_1g29494 CCTGTGGGACACTCACATTC
Gypsy 1_R FvH4_1g29494 GGAAGGGACAAGTTAGGAGC
Gypsy 2_F FvH4_1g28083 AGATCATGTCCTTTGAGGAGC
Gypsy 2_R FvH4_1g28083 CTTCAAGTGAGGACTTCGGT
Gypsy 3_F TTAACCCATTTCGACCCTATTT
Gypsy 3_R GGCTTCATTATGTTGCCTTTAC
Gypsy 4_F AGAGACCAGCATGCAAACCTTA
Gypsy 4_R TATGGCGGCACGTGGTAGTG
EXP_F FvH4_7g25860 CACTCGGTTTCGATCAAAGG
EXP_R FvH4_7g25860 TGACCTGAAAAGACAGGGCT
PYR-G1_F FvH4_7g31130 GGAGGTGCGAGTGAGTACATT
PYR-G1_R FvH4_7g31130 CGCTTTGATGTGCCTGACG
PYR-G2_F FvH4_7g31130 GGGAATAATAAGAATGGAGGAGGA
PYR-G2_R FvH4_7g31130 GAGCGTAGAGCTACACTGATG
PYR-P1_F GTGCGACATAGATAACCGGA
PYR-P1_R ACCTCATGTGTGATTTTACTGAA
PYR-P2_F TGGCCTTTGCACATATAACACT
PYR-P2_R CAAACTGAAACGAGTTGGAAGT
Silent-G1_F FvH4_4g05900 TCCTATGTTTACGCCGTTGG
Silent-G1_R FvH4_4g05900 GCGGGTGTACCTACAAGAATAG
Silent-G2_F FvH4_6g00740 CTGAAGGATTGAGTGCAGAATTG
Silent-G2_R FvH4_6g00740 CAGTTTCGGTTCGGGTAAGA