Skip to main content

Table 2 Primer sequences used in ChIP-qPCR assays

From: A native chromatin immunoprecipitation (ChIP) protocol for studying histone modifications in strawberry fruits

Primer names

Gene ID

Primer sequence (5′ → 3′)

Gypsy 1_F

FvH4_1g29494

CCTGTGGGACACTCACATTC

Gypsy 1_R

FvH4_1g29494

GGAAGGGACAAGTTAGGAGC

Gypsy 2_F

FvH4_1g28083

AGATCATGTCCTTTGAGGAGC

Gypsy 2_R

FvH4_1g28083

CTTCAAGTGAGGACTTCGGT

Gypsy 3_F

TTAACCCATTTCGACCCTATTT

Gypsy 3_R

GGCTTCATTATGTTGCCTTTAC

Gypsy 4_F

AGAGACCAGCATGCAAACCTTA

Gypsy 4_R

TATGGCGGCACGTGGTAGTG

EXP_F

FvH4_7g25860

CACTCGGTTTCGATCAAAGG

EXP_R

FvH4_7g25860

TGACCTGAAAAGACAGGGCT

PYR-G1_F

FvH4_7g31130

GGAGGTGCGAGTGAGTACATT

PYR-G1_R

FvH4_7g31130

CGCTTTGATGTGCCTGACG

PYR-G2_F

FvH4_7g31130

GGGAATAATAAGAATGGAGGAGGA

PYR-G2_R

FvH4_7g31130

GAGCGTAGAGCTACACTGATG

PYR-P1_F

GTGCGACATAGATAACCGGA

PYR-P1_R

ACCTCATGTGTGATTTTACTGAA

PYR-P2_F

TGGCCTTTGCACATATAACACT

PYR-P2_R

CAAACTGAAACGAGTTGGAAGT

Silent-G1_F

FvH4_4g05900

TCCTATGTTTACGCCGTTGG

Silent-G1_R

FvH4_4g05900

GCGGGTGTACCTACAAGAATAG

Silent-G2_F

FvH4_6g00740

CTGAAGGATTGAGTGCAGAATTG

Silent-G2_R

FvH4_6g00740

CAGTTTCGGTTCGGGTAAGA