Skip to main content

Table 2 Oligonucleotide primers used in this study

From: Rapid, high efficiency virus-mediated mutant complementation and gene silencing in Antirrhinum

Purpose Primer name Sequence (5′-3′) Notes
VIGS AscI-PDS-F TGGCGCGCCCAATGAGCCTTACCGTGCAT Adds Asc I sites to AmPDS fragment
AscI-PDS-R TGGCGCGCCGTAGTGCTTCAGAGGATCTTACAA
PDS-R GTAGTGCTTCAGAGGATCTTAC First-round AmPDS amplification
AscI-DIV-R AGGCGCGCCTACCCCATTCTAAGGTAAAAGG Adds Asc I site to Div fragment
PDS-DIVfusion-F gtaagatcctctgaagcactacCATATTTTTCCAGCTCAAGCTGG Adds PDS-R to Div fragment
AscI-Hutr-F AGGCGCGCCATAATACAAGTTGAGCAACAGCG Adds Asc I site to H 3′-UTR fragment
PDS-Hutrfusion-R gtaagatcctctgaagcactacACAGAGTGATACGCCTCGAT Adds PDS-R to H 3′-UTR fragment
H expression AscI-Hairy-F AGGCGCGCCATGCAGTACGACGCAGAACC Adds Asc I site 5′ to the H ORF
PDS-Hairyfusion-R gtaagatcctctgaagcactacTTAGAGCCAAAGAGCACCAGC Adds PDS-R 3′ to the Hairy ORF
AscI-SynH-F AGGCGCGCCAACAATGCAATATGATGCTGAGCCT Adds Asc I upstream of SynH ORF
FLAG-SynHfusion-R CTACTTGTCGTCATCGTCTTTGTAGTCCAACCACAATGCTCCTGCT Replaces H stop with FLAG-tag
FLAG-PDSfusion-R GACTACAAAGACGATGACGACAAGTAGgtagtgcttcagaggatcttac Adds FLAG to AmPDS fragment
RT-PCR AmPDS-qPCR-F TCTTTGTAATGGACGGCAAG RT-PCR for AmPDS
AmPDS-qPCR-R ACTTGCCAAACTCTTCCCTG
TRV-CP-F TGGGTTACTAGCGGCACTGA RT-PCR for TRV2 RNA
TRV-CP-R GCTCGTCTCTTGAACGCTGA
AmUbi-qPCR-F CCGAACCATCAGACAAACAAAC RT-PCR for AmUBI control
AmUbi-qPCR-R TACCCTGGCCGACTACAATA
AmACT-F CTTGGCCGTCTCCATTTCTT RT-PCR for AmACT control
AmACT-R TCCTCACAGAGCGTGGATATAG
H-qPCR-F2 ACCATCCACAACACTCTAATC RT-PCR for H
H-qPCR-R TGAATATCACCACCGGATTCTC
Div-F GGGTAGTGGTCATGGATTCG RT-PCR for Div
Div-R GGAAAGGAAGTTTGTGAATGGAG
  1. The Asc I restriction site, introduced to allow cloning into pTRV2sgP, is underlined. For overlap amplification of AmPDS fused to H or AmDIV sequences, AmPDS was first amplified with AscI-PDS-F and PDS-R and the H or Div sequence with one primer carrying an Asc I site and a reverse primer containing the complement of the PDS-R sequence at its 5′ end (lower case). Products were then fused by overlap PCR. To express SynH with a C-terminal FLAG-tag, the FLAG-encoding sequence (italics) was added in place of the SynH stop coding by amplification with FLAG-SynHfusion-R. To fuse the SynH-FLAG sequence to the AmPDS reporter, the AmPDS fragment was amplified with FLAG-PDSfusion-R, carring the FLAG-encoding sequence at its 5′ end
\