Skip to main content

Table 1 Candidate reference genes, amplicon characteristics and primer sequences

From: Evaluation of duplicated reference genes for quantitative real-time PCR analysis in genome unknown hexaploid oat (Avena sativa L.)

Gene Locus name in Oat Transcriptome [1] RPKM [1] Primers (5′–3′) Tm (℃) Amplicon length Efficiency (%) R2
PP2A Locus_1956_Transcript_6/10_Confidence_0.500_Length_1648 27.3738 F: GCCCTGAGCCTACAAGAACGG 63.6 196 bp 100.4 1
R: GCTGAGCGAACATGCTGAGAT 60.3    
UBQ10 Locus_4160_Transcript_1/1_Confidence_1.000_Length_1516 12.1493 F: GATCTCAGCTCTAGCGAATCTCC 59.4 136 bp 94.2 1
R: ATCCCTTCCTTGTCTTGAATCTTG 60.9    
EF1A Locus_565_Transcript_5/10_Confidence_0.529_Length_863 347.2181 F: GTGAAGATGATTCCCACCAAGC 60.9 87 bp 96.0 1
R: CCTCATGTCACGCACAGCAAA 62.7    
HNR Locus_4951_Transcript_1/4_Confidence_0.667_Length_1455 12.2775 F: ATTGGGTTTGTCACTTTCCGTAG 60.2 134 bp 101.5 1.000
R: CTTGGAGGGTGTCTCGCATCT 61.4    
EP Locus_827_Transcript_1/2_Confidence_1.000_Length_1359 19.8139 F: GCACAAGTGATGCCAGAATAGC 60.0 193 bp 112.4 1
R: CGAGATGCATTAGATTCGTTGG 60.1    
TBC Locus_9878_Transcript_1/1_Confidence_1.000_Length_1218 4.3017 F: TCCTCTTTCACCTCCCGATTAC 60.0 98 bp 92.7 1
R: CAGATGCTTGCCCTTCTACCTC 60.7    
EIF4A Locus_3892_Transcript_3/4_Confidence_0.667_Length_1160 45.0042 F: TCTCGCAGGATACGGATGTCG 63.3 88 bp 100.8 0.99
R: TCCATCGCATTGGTCGCTCT 63.6    
18S Locus_29_Transcript_3/10_Confidence_0.100_Length_1865 1067.4606 F: TTCTTAGTTGGTGGAGCGATTT 58.7 150 bp 100.4 1
Locus_29_Transcript_4/10_Confidence_0.100_Length_1865 1052.7564 R: CCTGTTATTGCCTCAAACTTCC 58.5    
GAPDH1 Locus_535_Transcript_3/4_Confidence_0.500_Length_1198 291.0028 F: CTTCAACATCATTCCCAGCAG 58.0 288 bp 110.7 1
Locus_1038_Transcript_1/4_Confidence_0.583_Length_1013 393.7014 R: GCCTTGGCGTCAAAGATGCT 62.6    
TUA6 Locus_855_Transcript_1/4_Confidence_0.727_Length_1544 28.0927 F: CCCAACAATGTGAAGTCCAGC 60.2 121 bp - -
Locus_882_Transcript_1/5_Confidence_0.692_Length_1361 164.8515 R: TGAACTGCTCACTCACCCTCC 59.7    
Locus_3988_Transcript_3/5_Confidence_0.615_Length_1286 24.3489      
UBC21 Locus_10069_Transcript_1/3_Confidence_0.750_Length_710 7.3384 F: GCCCATCGGAGACACCTTTTG 64.0 133 bp 97.8 0.99
Locus_10069_Transcript_2/3_Confidence_0.750_Length_723 6.3587 R: CCTGTCTTGAAGTGAACATTTGG 59.1    
Locus_3507_Transcript_3/4_Confidence_0.500_Length_967 13.6740      
Locus_3507_Transcript_2/4_Confidence_0.700_Length_1018 16.8311      
  1. Both the locus name and the RPKM value were obtained from Gutierrez-Gonzalez et al. [1]