Skip to main content

Table 1 CRISPR RNA oligonucleotide sequences used for cleavage of genomic DNA in the apple MYB10 locus

From: CRISPR-Cas9 enrichment and long read sequencing for fine mapping in plants

Name Sequence 5′-3′ Off-target score (%) On-target activity score (%) Chr Start position End position
crRNA_RF_1_F GTCATATCTAAGGACCCGCGTGG 100 76.30 Chr09 35542701 35542723
crRNA_RF_2_F TCTGTACTCCGTCTGTCGGTCGG 100 77.90 Chr09 35542848 35542870
crRNA_RF_3_R AGAAGACTGTCAATCCCGAGTGG 100 79.60 Chr09 35550689 35550711
crRNA_RF_4_F TGTCTGGAAAGTTTCTAACGCGG 100 70.80 Chr09 35551878 35551900
  1. Off-target score (specificity) for guide RNA sequences were calculated according to [51] against (‘Golden Delicious’ double haploid GDDH13v1.1) [34], with a score of 100% predicting low off target activity. On target activity scores (efficiency) were calculated according to [52].