Skip to main content

Table 2 Primer and probes of endogenous reference genes used in this study

From: Development of a universal endogenous qPCR control for eukaryotic DNA samples

Target geneTarget speciesPrimer name5′–3′ sequenceReferences
28SEukaryotesUNI28S-fwdCTACTATCTAGCGAAACCThis work
UNI28S-revAYTAGAGTCAAGCTCAAC
UNI28S-PHEX-AAA + G+A + AG + A+C + C+C + T-DAB
cpLeuMalus × domesticaqMD_cpLeu-fwdCCTTCATCCTTTCTGAAGTTTCG[24]
qMD_cpLeu-revAACAAATGGAGTTGGCTGCAT
qMD_cpLeuHEX-TGGAAGGATTCCTTTACTAAC-TAMRA
acoMalus × domesticaMd-ACO-FCCAGAATGTCGATAGCCTCGTT[25]
Md-ACO-RGGTGCTGGGCTGATGAATG
Md-ACOHEX-TACAACCCAGGCAACG
  1. A +prior to the nucleotide code indicates that the following nucleotide is an LNA