Skip to main content

Advertisement

Table 3 Primer information for 17 SSRs

From: Molecular karyotypes of loquat (Eriobotrya japonica) aneuploids can be detected by using SSR markers combined with quantitative PCR irrespective of heterozygosity

SSR namePrimer sequences (5′ → 3′)OriginLG in loquatProduct size/bpT (°C)
TsuENH094F: GAAGAAGCAAAACCCGAAGA
R: TTGTTCTCCTCGCCACCTT
PearLG115560
MEST028F: ATTGGCATTGCTTCTCACC
R: TGCAACAACAATTCCCTTCA
AppleLG214860
CH03g12F: GCGCTGAAAAAGGTCAGTTT
R: CAAGGATGCGCATGTATTTG
AppleLG3154–20060
TsuENH044F: TGGCTAAATACTCTTCTCGAAAACAA
R: GTGATTATTATAGATACCAAGCCTCTC
PearLG412760
NZmsCN898349F: GAGTTGGCAGAAAGAAACCA
R: CTGGGTGAAGACGAGATGCT
AppleLG520060
NZmsCO754252F: CTGCCCTCAAGGAGAATGTC
R: ACAGGTGCAGCAAAGGCTAT
AppleLG619560
NZmsEB137749F: ATCTCCTGCTGTGCTGGTCT
R: TCACCAAACACCAATCAACAA
AppleLG722060
TsuENH034F: CATTATCCATTTGATTAAACTACACG
R: GGTAGAAAGAGAAGGAAAGTGGG
PearLG815160
TsuENH097F: CTGACACCCACTACGATTCAAGA
R: AAACGAGCTTGGTACGGATTACA
PearLG916260
Hi05b02F: GATGCGGTTTGACTTGCTTC
R: GTTTCTCCAGCTCCCATAGATTGC
AppleLG10120–17860
IPPN14F: GAGGAAGTAACCGCATCAGC
R: TCTAAGGGCAGGCAGATCAC
PearLG11223–25260
MEST011F: GCGTGAGTTGAGCAAGATGG
R: TAGAAGCAATAAGGTGGAGTGGT
AppleLG1220560
CH02e02F: CTCATCAGTCTCACTGACTGTGTG
R: AGGGTCAGGGTCAGTCAGG
AppleLG13122–13060
TsuENH093F: AGACTGCTGAGGGAATCCATAA
R: TTCCGAGTCAAATGGGGC
PearLG1414460
TsuENH007F: ATTCATTGCACCGACTACCGATT
R: AGTGGCGTAGTGGGAAGGG
PearLG1516660
Hi22f06F: CAATGGCGTCTGTGTCACTC
R: GTTTACGACGGGTAAGGTGATGTC
AppleLG16240–24660
TsuENH002F: CAGCAGGAAACACAGAAAAACAG
R: ATATCGAGCAATCAAGGAAGCAG
PearLG1711660
  1. The primers for TsuENH094, TsuENH044, TsuENH034, MEST011, TsuENH093, and TsuENH007 were designed by the authors based on the expressed sequences (National Center for Biotechnology Information, NCBI). The information on the LGs in loquat was obtained from Fukuda et al. [27]