Skip to main content

Advertisement

Table 3 Primers of in situ hybridization probe of BrrCLV3 gene and BrrWUSa gene

From: Establishment and optimization of mRNA in situ hybridization system in turnip (Brassica rapa var. rapa)

Gene Forward primer Reverse primer
Probe of BrrCLV3 5′ATGGATTCGAGGACTCTGGTGCT3′ 5′TTAAGGGATATGAGAGTCGGTTCG3′
Probe of BrrWUSa 5′CCCTTGTGCTTCTCTAAAGCTATGC3′ 5′CGTACTGAAATAGGCTTAAATTCCA3′