Skip to main content

Advertisement

Table 2 Probe sequences of BrrCLV3 and BrrWUSa genes in situ hybridization

From: Establishment and optimization of mRNA in situ hybridization system in turnip (Brassica rapa var. rapa)

Gene Probe sequence
BrrCLV3 ATGGATTCGAGGACTCTGGTGCTACTGCTGCTCTTTTGCCTCATGTT
CCTGCATGATGCTTCTGATATCACTCACGCCAATGCCAATGTTCATG
CACTTCCCATTCGCAAGATGATGGTAATGAAGAAGGATAATGAATG
GGGAGGAGCAAATGGAATTGAAGAAGAGAAGGAGAAGGTTTTCG
GGTTAAATGAAGAACTAAGGACTGTCCCTTCAGGACCTGACCCTTT
GCACCATCATGTGAACCCCCCAAGAAAGCCACGAACCCGACTCTCA
TATCCCT
BrrWUSa CGTACTGAAATAGGCTTAAATTCCATATTAATATAATTTCAATGTGTT
ACATTATAAAAGAAAGGAGAAAAACACACTCGAATAAAGTTAAAC
CTAGACGATAGTAATTACAATTTATTAAACTACGTACGTACGGAAGA
TACTGCTATTACTGAATAATACGGGCCAACCATGCGAATATGCGATT
GAAGCTAAAGAGCGTAGGAGTTCAGACGTAGCTCAAGAAAGTATT
AATCCTGTGTGACGCCGGCGGCGTAGGAGTTCAGGCATAGCTTTAG
AGAAGCACAAGGG