Skip to main content

Table 1 Primers for the amplification of full-length CDS of BrrCLV3 and BrrWUSa gene

From: Establishment and optimization of mRNA in situ hybridization system in turnip (Brassica rapa var. rapa)

Gene Forward primer Reverse primer
BrrCLV3 5′ATGGATTCGAGGACTCTGGTGCT3′ 5′TTAAGGGATATGAGAGTCGGTTCG3′
BrrWUSa 5′ATGGAGCCACCGCAACATCATCATC3′ 5′ATCCTGTGTGACGCCGCGGCGTGGG3′