Skip to main content

Advertisement

Table 2 Primers for indexing PCR (indexed sequencing primers)

From: A high-throughput amplicon-based method for estimating outcrossing rates

Primer name Sequence Index set origin index name
F1_MetaIndex AATGATACGGCGACCACCGAGATCTACACTATAGCCTTCGTCGGCAGCGTC TruSeq i5 D501
F2_MetaIndex AATGATACGGCGACCACCGAGATCTACACATAGAGGCTCGTCGGCAGCGTC TruSeq i5 D502
F3_MetaIndex AATGATACGGCGACCACCGAGATCTACACCCTATCCTTCGTCGGCAGCGTC TruSeq i5 D503
F4_MetaIndex AATGATACGGCGACCACCGAGATCTACACGGCTCTGATCGTCGGCAGCGTC TruSeq i5 D504
F5_MetaIndex AATGATACGGCGACCACCGAGATCTACACAGGCGAAGTCGTCGGCAGCGTC TruSeq i5 D505
F6_MetaIndex AATGATACGGCGACCACCGAGATCTACACTAATCTTATCGTCGGCAGCGTC TruSeq i5 D506
F7_MetaIndex AATGATACGGCGACCACCGAGATCTACACCAGGACGTTCGTCGGCAGCGTC TruSeq i5 D507
F8_MetaIndex AATGATACGGCGACCACCGAGATCTACACGTACTGACTCGTCGGCAGCGTC TruSeq i5 D508
R13_MetaIndex CAAGCAGAAGACGGCATACGAGATGTCGTGATGTCTCGTGGGCTCGG TruSeq Amplicon A701
R14_MetaIndex CAAGCAGAAGACGGCATACGAGATCGAGTAATGTCTCGTGGGCTCGG TruSeq i7 D701
R15_MetaIndex CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTCTCGTGGGCTCGG TruSeq i7 D702
R16_MetaIndex CAAGCAGAAGACGGCATACGAGATAATGAGCGGTCTCGTGGGCTCGG TruSeq i7 D703
R17_MetaIndex CAAGCAGAAGACGGCATACGAGATGGAATCTCGTCTCGTGGGCTCGG TruSeq i7 D704