Skip to main content

Advertisement

Table 1 Primers for Primary PCR

From: A high-throughput amplicon-based method for estimating outcrossing rates

Primer name Sequence
1_Carubv10013869m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCACTCATCCATTCGGAAAT
1_Carubv10013869m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTGGGGACAAGGTGCTAATC
2_Carubv10023806m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTACCGACCACATAGGCATCA
2_Carubv10023806m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAATGGCCGATTCTGCTTTTA
3_Carubv10018138m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCAAGCCAAAGTTTGATGCTT
3_Carubv10018138m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACTCGTCTGCAGTCATGGTG
4_Carubv10001640m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGAAGCGGATGGTTACAAAA
4_Carubv10001640m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGGCCAAGCTCACTCACATT
5_Carubv10001924m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTGGGTTCAGATTGAGCGTAA
5_Carubv10001924m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAACTTGATCCTCTTTGGTACTGG
6_Carubv10023818m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTTCTTTTTCTGAGATTCCATTGCT
6_Carubv10023818m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGAAGCCTCTCCTGAGAAGTGA
7_Carubv10005658m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAAGATCTGTGCTTGCTG
7_Carubv10005658m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCAGCTCCGGATGGTTAAAT
8_Carubv10006001 m _F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTTTCAAAAGCTTTGCGTGAG
8_Carubv10006001 m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGATGCTTCACGTTCACACCA
9_Carubv10006101m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTTCTATCCAAGGGCCATCA
9_Carubv10006101m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCCATGGAAACTCCTTGTTG
10_Carubv10027375m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGATCCGTCGGCTCTTCTCTC
10_Carubv10027375m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAACCATGCCAATGCTTCATA
11_Carubv10011729m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGAGCAAGTCCCAAACAAAG
11_Carubv10011729m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCATTTCAAGCCGCTCTGG
12_Carubv10014733m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTGCATTCGATCTCGATCTTG
12_Carubv10014733m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCGGTGGTGAAGACAACAATC
Primers targeting same sequences as above, but with added T or A before gene-specific sequence for heterogeneity
1A_Carubv10013869m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGACCACTCATCCATTCGGAAAT
1A_Carubv10013869m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGATTGGGGACAAGGTGCTAATC
2T_Carubv10023806m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTTACCGACCACATAGGCATCA
2T_Carubv10023806m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTAATGGCCGATTCTGCTTTTA
3A_Carubv10018138m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGACAAGCCAAAGTTTGATGCTT
3A_Carubv10018138m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAACTCGTCTGCAGTCATGGTG
4T_Carubv10001640m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTGGAAGCGGATGGTTACAAAA
4T_Carubv10001640m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTAGGCCAAGCTCACTCACATT
5A_Carubv10001924m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATGGGTTCAGATTGAGCGTAA
5A_Carubv10001924m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAAACTTGATCCTCTTTGGTACTGG
6T_Carubv10023818m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTTTCTTTTTCTGAGATTCCATTGCT
6T_Carubv10023818m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTAGAAGCCTCTCCTGAGAAGTGA
7A_Carubv10005658m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATCCAAGATCTGTGCTTGCTG
7A_Carubv10005658m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGATCAGCTCCGGATGGTTAAAT
8T_Carubv10006001m _F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTTTTCAAAAGCTTTGCGTGAG
8T_Carubv10006001m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTGATGCTTCACGTTCACACCA
9A_Carubv10006101m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAGTTCTATCCAAGGGCCATCA
9A_Carubv10006101m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACCCATGGAAACTCCTTGTTG
11T_Carubv10011729m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTGGAGCAAGTCCCAAACAAAG
11T_Carubv10011729m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCATTTCAAGCCGCTCTGG
12A_Carubv10014733m_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATGCATTCGATCTCGATCTTG
12A_Carubv10014733m_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACGGTGGTGAAGACAACAATC