Skip to main content

Table 1 The description of candidate reference genes and primers used in this study

From: Selection and validation of reference genes for quantitative expression analysis of miRNAs and mRNAs in Poplar

Gene symbol Gene name Gene ID Arabidopsis homolog Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′) Size (bp) E (%) R2
EIF4A Eukaryotic initiation factor 4A Potri.005G093900 AT3G19760 TACATTCATCGAATTGGTCGTTCTGGT TTCATAGGCATTTCGTCAATCTGGG 137 101.50 0.995
GAPDH Glyceraldehyde-3-phosphate dehydrogenase Potri.012G094100 AT1G13440 AACCGACTTCATTGGTGACAACCG CCACTCATTGTCATACCACGCAAC 106 100.72 0.997
Histone Histone superfamily protein Potri.005G072300 AT4G40030 ACTGTTGCTCTTCGTGAAATCCGTA CTTAAAATCCTGGGCAATTTCACGAAC 105 96.62 0.998
PP2A-2 Protein phosphatase 2A-2 Potri.015G068300 AT1G10430 ACAGTTCAACCACACTAATGGGCTC TTTGGCGCACTGAACACTGTAACCAC 114 103.41 0.988
PP2A-A2 Protein phosphatase 2A subunit A2 Potri.010G127500 AT3G25800 ATGAATTTCCTGATGTGCGACT CAATGCCTATCCTCTGCAAGCTC 127 99.23 0.998
RPS18 Ribosomal protein S18 Potri.006G170500 AT1G07210 AGGCTCATCATCTTATCAAATCCCT TCAATGCCACCAAATATTCGTTGCT 127 103.69 0.990
UBQ10 Polyubiquitin 10 Potri.001G418500 AT4G05320 GTTGATTTTTGCTGGGAAGC GATCTTGGCCTTCACGTTGT 192 98.18 1.000
ATPase ATP synthase subunit B Potri.004G177500 AT4G38510 ACTCATCCCACCCCTGATCTTACGG ACCAATGGCACTCTTCATGAGACGA 138 101.65 0.995
UBP Oligouridylate binding protein 1B Potri.006G279600 AT1G17370 GGCTTTGTTTCATTCCGTAATCAGCA AACACCTTTAGTTGCCCAATTGCAT 111 100.92 0.978
bHLH bHLH transcription factor Potri.011G132400 AT5G54680 ATCTGAATCGTGTAGTGCGTCTAGCTC GCATCAACCAAAATAGCAGCCTTGTCC 147 101.61 0.985
U6-1 Small nuclear ribonucleoprotein family protein Potri.001G166600 AT3G14080 GTGACCTTTATTGCGACATCCACT CTTCTGAAACACGAGTCATATGTGGT 123 96.16 0.995
U6-2 Small nuclear ribonucleoprotein family protein Potri.008G078400 AT2G43810 GCCTGTTGTGGTTAAGCTCAATTCTG TTCCTCGTATGAAAGCATCACCAT 149 99.12 0.999
5.8s 5.8S ribosomal RNA gene AJ006440   ACGTCTGCCTGGGTGTCAC TCAACCACCGCTCGTCGTG 145 108.37 0.993