Skip to main content

Table 1 Candidate reference genes and target genes description and primer sequences

From: Evaluation of reference genes for normalizing RT-qPCR in leaves and suspension cells of Cephalotaxus hainanensis under various stimuli

Gene abbreviationGene namePrimer sequences (5′-3′) (forward/reverse)Amplicon productE (%)
Amplification efficiency
R2
Correlation coefficients
Tm (°C)Length (bp)
ACTActin7CAGATGTGGATTAGCAAG/CAAGCCGTAGTAGGTAAT79.59992.20.988
UBQUbiquitin 10CTTGAGGATGGTCGCACCTT/GTCGGAGCTTTCCACTTCCA83.714498.60.998
NACNAC domain-containing proteinAGGCGTGAAGAAAGTCCTGG/CGGTACTCGTGCATGATCCA82.78198.30.993
F-boxF-box family proteinAAGAGAACAGTGGTAGAC/TTGGTAGCAGGATTAAGG81.8104101.30.992
PP2CProtein phosphatase 2CCGACTGATAATGGAATGG/CGGAAACTGTAGGTACTA82.012398.80.999
TUAAlpha-tubulinTCAGTGGATTATGGCAAGA/TAGAAGGGAATGGGTTGAC76.611497.50.990
TUBBeta-tubulinCTCACAGCAATACATAGCC/TCAGCAGCACACATCATA78.88191.10.998
UBCUbiquitin-conjugating Enzyme E2CTCTACCAATCCACCAGTT/GCAAGCCACCAGATAATG77.8100100.90.998
18S18S ribosomal RNACAATGGCAATGACAATGG/CAGAGAACAATCCGAACT81.77595.10.999
ChNCSNorcoclaurine synthaseAGAGGTAATGAGCAATGG/TGAGGCGTCTACAAGTTC82.514398.50.996