Skip to main content

Table 1 Reference gene primer sequences and amplicon characteristics for each primer pair used in the RT-qPCR

From: Selection of the optimal reference genes for expression analyses in different materials of Eriobotrya japonica

Gene

Gene description

GenBank ID

Primer sequence (5′–3′)

Amplicon length (bp)

Amplicon Tm (°C)

Amplification efficiency (%)

Regression coefficient (R2)

RPL4

Ribosomal protein L4

MH196506

F: AGGTTCAGTCAGTCGTCAGGC

215

81.59

102.91

0.994

   

R: GGCGGTAGCCTCCTCCTTAG

    

RPL18

Ribosomal protein L18

MH196507

F: ATGGGATTTGGCTTCGTTATC

177

82.17

106.49

0.999

   

R: AGAGTTTTGCTGGGATGGTG

    

HIS3

Histone H3.3

MH196508

F: GTTTCCAGAGCCACGCGG

156

84.93

92.83

0.999

   

R: CACGCTCACCCCTGATCCTC

    

TUA3

Alpha-tubulin-3

MH196509

F: ATGGTATGATGCCCAGTGACACC

144

81.49

108.74

0.999

   

R: GACGGTTATTGATGAAGTCAGGACTG

    

SAMDC

s-Adenosyl methionine decarboxylase

MH196510

F: CAGCTGAGTTCTCCATAGCCTTG

162

83.99

99.05

0.999

   

R: AATCATCCTTGACAAAGCGGTG

    

TIP41

TIP41-like family protein

MH196511

F: TGATGGGGCACTAATGAGGC

202

81.07

126.43

0.996

   

R: GTCTTATGCATGATCACAGGAAGC

    

UGPase

(UDP)-glucose pyrophosphorylase

MH196512

F: ACATTACAAGATGGCTTTGTTACCC

157

79.94

93.33

0.996

   

R: CAGAAACCTTAAGGCTATCAAGCTC

    

18S

18S ribosomal RNA

AB636342.1

F: AAGTCGTAACAAGGTTTCCGTAG

80

80.10

118.84

0.999

   

R: CCGATTCTCTGGTCGTTCTG

    

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

JQ731608.1

F: TACAGTTCCCGTGTGGTTGA

139

79.90

104.97

0.998

   

R: CGAGAGGACGCAAGATAACA

    

PIP2

Plasma intrinsic protein 2

JX041626.1

F: ATCATCGGCACCTTCGTC

124

85.29

94.92

0.997

   

R: GCACAATAAACACAGCAAACC

    

ACT

Actin

AB710173.1

F: CTTTCCCTCTATGCCAGTG

122

80.58

105.39

0.999

   

R: CAAGGTCAAGCCTCAAGAT