Skip to main content

Table 1 Reference gene primer sequences and amplicon characteristics for each primer pair used in the RT-qPCR

From: Selection of the optimal reference genes for expression analyses in different materials of Eriobotrya japonica

Gene Gene description GenBank ID Primer sequence (5′–3′) Amplicon length (bp) Amplicon Tm (°C) Amplification efficiency (%) Regression coefficient (R2)
RPL4 Ribosomal protein L4 MH196506 F: AGGTTCAGTCAGTCGTCAGGC 215 81.59 102.91 0.994
RPL18 Ribosomal protein L18 MH196507 F: ATGGGATTTGGCTTCGTTATC 177 82.17 106.49 0.999
HIS3 Histone H3.3 MH196508 F: GTTTCCAGAGCCACGCGG 156 84.93 92.83 0.999
TUA3 Alpha-tubulin-3 MH196509 F: ATGGTATGATGCCCAGTGACACC 144 81.49 108.74 0.999
SAMDC s-Adenosyl methionine decarboxylase MH196510 F: CAGCTGAGTTCTCCATAGCCTTG 162 83.99 99.05 0.999
TIP41 TIP41-like family protein MH196511 F: TGATGGGGCACTAATGAGGC 202 81.07 126.43 0.996
UGPase (UDP)-glucose pyrophosphorylase MH196512 F: ACATTACAAGATGGCTTTGTTACCC 157 79.94 93.33 0.996
18S 18S ribosomal RNA AB636342.1 F: AAGTCGTAACAAGGTTTCCGTAG 80 80.10 118.84 0.999
GAPDH Glyceraldehyde-3-phosphate dehydrogenase JQ731608.1 F: TACAGTTCCCGTGTGGTTGA 139 79.90 104.97 0.998
PIP2 Plasma intrinsic protein 2 JX041626.1 F: ATCATCGGCACCTTCGTC 124 85.29 94.92 0.997
ACT Actin AB710173.1 F: CTTTCCCTCTATGCCAGTG 122 80.58 105.39 0.999