Skip to main content

Table 2 List of primers used for gene cloning and vector construction

From: Simple protoplast isolation system for gene expression and protein interaction studies in pineapple (Ananas comosus L.)

Aco004213.1-F CACCATGGCGCAGGGGTCGATGAA
Aco004213.1-R AGACCCGACGAGGCCTTTGTA
Aco004963.1-F CACCATGCGGCGCACGGGGCTC
Aco004963.1-R CTCGAGCAAGCGCCTGCGCTT
YFPn-AtJAZ3-F CACCATGGAGAGAGATTTTCTCGGG
YFPn-AtJAZ3-R TTAGGTTGCAGAGCTGAGAGAAG
AtMYC2-YFPc-F CACCATGACTGATTACCGGCTACAACC
AtMYC2-YFPc-R ACCGATTTTTGAAATCAAACTTG