Table 1 Candidate reference genes, target transcripts and respective primers pairs used in the present work
From: Cowpea and abiotic stresses: identification of reference genes for transcriptional profiling by qPCR
Gene | Anchor specie* | Cellular function | Primer sequences | Amplicon size (bp) | References |
|---|---|---|---|---|---|
VuACT | Vigna unguiculata (Contig16004) | Diverse functions, ranging from cell motility to maintenance of cell shape and polarity | F: TCAGGTGTCCAGAGGTGTTGTA R: ATGGTTGTGCCTCCTGAAAGTA | 151 | CpFGC Database |
VuUBQ10 | Vigna unguiculata (Contig282) | Protein ubiquitination pathway | F: GTCTAAGGGGAGGAATGCAGAT R: CAAAGATCAACCTCTGCTGGTC | 150 | CpFGC Database |
β-TUB | Phaseolus vulgaris (XM_007147394.1) | Internal cell architecture maintenance drives cytoplasmic streaming and others | F: CCGTTGTGGAGCCTTACAAT R: GCTTGAGGGTCCTGAAACAA | 117 | [25] |
EF1-α | Phaseolus vulgaris (XM_007151727.1) | Enzymatic release of aminoacyl tRNAs to the ribosome | F: GGTCATTGGTCATGTCGACTCTG R: GCACCCAGGCATACTTGAATGACC | 146 | [26] |
FBOX | Phaseolus vulgaris (XM_007131876.1) | Mediation of protein–protein interaction | F: CACCAGGATGCAAAAGTGG R: ATCCGCTTGTCCCTTGAAC | 163 | [27] |
UE21D | Phaseolus vulgaris (XM_007145751.1) | Protein ubiquitination pathway; DNA repair pathway | F: AGAAAAGCCCCCAAGTGTTC R: CTGCCATCTCCTTCTTCAGC | 161 | [27] |
UNK | Phaseolus vulgaris (XM_007131494.1) | Unknown function, putatively a membrane-associated protein | F: ATTCCCATCATGCAGCAAAG R: AGATCCCTCCAGGTCAATCC | 192 | [27] |
ZMP | Phaseolus vulgaris (XM_007162147.1) | Metalloproteinase (i.e., protease enzyme whose catalytic mechanism involves a metal) | F: GCAACCAACCTTTCATCAGC R: AGAAATGCCTCAACCCTTTG | 156 | [27] |
GAPC | Glycine max (XM_003526927.3) | Catalyzes an essential energy-yielding step in carbohydrate metabolism | F: ATCAGCCAAGGACTGGAGAG R: ACGGAATGCCATACCAGTCA | 130 | [13] |
VuCHiB | Vigna unguiculata (Contig5335) | Hydrolytic enzyme that breaks down glycosidic bonds in chitin. It plays an important role not only in plant defense but also in various abiotic stresses | F: CCATCTGGTTCTGGATGACC R: CCGTTGATGATGTTCGTCAC | 130 | CpFGC Database |
VuLTP | Vigna unguiculata (Contig14261) | Play important roles in biotic and abiotic stresses responses | F: TGTGATGATGGAAGCGAATG R: TGAGCAGCAATCAGAGGTTG | 124 | CpFGC Database |
VuCHI | Vigna unguiculata (Contig12804) | Catalyzes the conversion of naringenin chalcone to naringenin and is strictly required for flavonoid production | F: CACATACCATTTCCCAGCAG R: TGGAAGACACTGCCCTTGAG | 149 | CpFGC Database |
VuCHS | Vigna unguiculata (Contig7106) | Catalyzes the first committed step in the flavonoid biosynthetic pathway | F: GACTGCACAGACCATTGCAC R: GGATCGAAGGCTTCAGAAAG | 144 | CpFGC Database |