Skip to main content

Table 1 Candidate reference genes, target transcripts and respective primers pairs used in the present work

From: Cowpea and abiotic stresses: identification of reference genes for transcriptional profiling by qPCR

Gene Anchor specie* Cellular function Primer sequences Amplicon size (bp) References
VuACT Vigna unguiculata
(Contig16004)
Diverse functions, ranging from cell motility to maintenance of cell shape and polarity F: TCAGGTGTCCAGAGGTGTTGTA
R: ATGGTTGTGCCTCCTGAAAGTA
151 CpFGC Database
VuUBQ10 Vigna unguiculata
(Contig282)
Protein ubiquitination pathway F: GTCTAAGGGGAGGAATGCAGAT
R: CAAAGATCAACCTCTGCTGGTC
150 CpFGC Database
β-TUB Phaseolus vulgaris
(XM_007147394.1)
Internal cell architecture maintenance drives cytoplasmic streaming and others F: CCGTTGTGGAGCCTTACAAT
R: GCTTGAGGGTCCTGAAACAA
117 [25]
EF1-α Phaseolus vulgaris
(XM_007151727.1)
Enzymatic release of aminoacyl tRNAs to the ribosome F: GGTCATTGGTCATGTCGACTCTG
R: GCACCCAGGCATACTTGAATGACC
146 [26]
FBOX Phaseolus vulgaris
(XM_007131876.1)
Mediation of protein–protein interaction F: CACCAGGATGCAAAAGTGG
R: ATCCGCTTGTCCCTTGAAC
163 [27]
UE21D Phaseolus vulgaris
(XM_007145751.1)
Protein ubiquitination pathway; DNA repair pathway F: AGAAAAGCCCCCAAGTGTTC
R: CTGCCATCTCCTTCTTCAGC
161 [27]
UNK Phaseolus vulgaris
(XM_007131494.1)
Unknown function, putatively a membrane-associated protein F: ATTCCCATCATGCAGCAAAG
R: AGATCCCTCCAGGTCAATCC
192 [27]
ZMP Phaseolus vulgaris
(XM_007162147.1)
Metalloproteinase (i.e., protease enzyme whose catalytic mechanism involves a metal) F: GCAACCAACCTTTCATCAGC
R: AGAAATGCCTCAACCCTTTG
156 [27]
GAPC Glycine max
(XM_003526927.3)
Catalyzes an essential energy-yielding step in carbohydrate metabolism F: ATCAGCCAAGGACTGGAGAG
R: ACGGAATGCCATACCAGTCA
130 [13]
VuCHiB Vigna unguiculata
(Contig5335)
Hydrolytic enzyme that breaks down glycosidic bonds in chitin. It plays an important role not only in plant defense but also in various abiotic stresses F: CCATCTGGTTCTGGATGACC
R: CCGTTGATGATGTTCGTCAC
130 CpFGC Database
VuLTP Vigna unguiculata
(Contig14261)
Play important roles in biotic and abiotic stresses responses F: TGTGATGATGGAAGCGAATG
R: TGAGCAGCAATCAGAGGTTG
124 CpFGC Database
VuCHI Vigna unguiculata
(Contig12804)
Catalyzes the conversion of naringenin chalcone to naringenin and is strictly required for flavonoid production F: CACATACCATTTCCCAGCAG
R: TGGAAGACACTGCCCTTGAG
149 CpFGC Database
VuCHS Vigna unguiculata
(Contig7106)
Catalyzes the first committed step in the flavonoid biosynthetic pathway F: GACTGCACAGACCATTGCAC
R: GGATCGAAGGCTTCAGAAAG
144 CpFGC Database
  1. Candidate reference genes (VuACT: actin; VuUBQ10: polyubiquitin 10; β-TUB: beta-tubulin; EF1-α: elongation factor 1-alfa; FBOX: F-box protein; UE21D: ubiquitin-conjugating enzyme E2 variant 1D; UNK: Phaseolus vulgaris unknown gene; ZMP: zinc metalloproteinase; GAPC: glyceraldehyde-3-phosphate dehydrogenase C-subunit). Target transcripts (VuCHiB: chitinase B; VuLTP: lipid transfer protein; VuCHI: chalcone isomerase; VuCHS: chalcone synthase). Vu (Vigna unguiculata). *Based on RefSeq-NCBI and Cowpea Functional Genome Consortium (CpFGC) databases