Skip to main content

Table 3 3C primers for NlaIII restriction profile

From: A cautionary note on the use of chromosome conformation capture in plants

Name Gene locus and restriction enzyme Primer on Seq 5′ to 3′
PDS7922 SOC1_NlaIII Fragment A ACCGTTGGATGAAAGAGCAT
PDS7923 SOC1_NlaIII Fragment B CGCGTCTACAGAAAGTTAACCA
PDS7924 SOC1_NlaIII Fragment C TGACCTTACCCACATAGAAACAC
PDS7925 SOC1_NlaIII Fragment D GCCAAACCAACATCACAAAA
PDS7926 SOC1_NlaIII Fragment E GAAAACAAAAGGAGCGAAAAA
PDS7927 SOC1_NlaIII Fragment F TTTTTCCCACCCTTATTTCTC
PDS7928 SOC1_NlaIII Fragment G CATTGCCCCATTGTCTCTGT
PDS7920 SOC1_NlaIII Fragment H ATCCTCGAAAGCTTCCTCCT
PDS7929 SOC1_NlaIII Fragment I AATCATCTGTCTCTCTCTTTCTCAA
PDS7930 SOC1_NlaIII Fragment J TGAAAATGCCAGCTTTTGAT
PDS7931 SOC1_NlaIII Fragment K GAGCGGTAATGAATATAACCACAA
PDS7932 SOC1_NlaIII Fragment L TTGGTTATCTTCAATCATCAACCT
PDS7933 SOC1_NlaIII Fragment M TGATTCTGAACTGCTTGTGTTATG
PDS7934 SOC1_NlaIII Fragment N ATCCATTGGCCAAAAATCAA
PDS7935 SOC1_NlaIII Fragment O GAGGCTTTTAGCCCATCAAA
PDS7936 SOC1_NlaIII Fragment P CGACGTCGCACGATTTATTA
PDS7939 TIP41_Like NlaIII Bait-TSS CCGGCCTAGTTTCATTTTAGTT
PDS7940 TIP41_Like NlaIII − 1000 CGAGCACAAATACAAAACCG