Skip to main content

Table 2 3C primers for FspBI restriction profile

From: A cautionary note on the use of chromosome conformation capture in plants

Name Gene locus and restriction enzyme Primer on Seq 5′ to 3′
PDS6848 SOC1_FspBI Fragment I AGATTCTCAAACATCAGTCGGA
PDS6849 SOC1_FspBI Fragment II ACAAAAGGAGTAGGTTTCTGGA
PDS6850 SOC1_FspBI Fragment III TGAGCTTATGACTGGTAAACTC
PDS6851 SOC1_FspBI Fragment IV GTTTTGGATTTGTCTCAACCAG
PDS7489 SOC1_FspBI Fragment V TGGTCCTCCTCCCGATATAGA
PDS6852 SOC1_FspBI Fragment VI ACGAGAGAGTGTTTGTGTCC
PDS6847 SOC1_FspBI Fragment VII (Bait) GACGTTTGCTTTGAGAGGTG
PDS6853 SOC1_FspBI Fragment VIII GCTTCATTTCATGCTCATTCC
PDS6854 SOC1_FspBI Fragment IX ACTTCTTTCTCTCGAACCTACT
PDS6855 SOC1_FspBI Fragment X AGTAAGTAAGCCTCTTGTGCT
PDS6856 SOC1_FspBI Fragment XI AGCTGCTTCTCTCTTGTTGT
PDS6857 SOC1_FspBI Fragment XII AAGGGCCTACTTTGCGATAA
PDS7307 TIP41_Like FspBI Bait-TSS GTTTCGATCTCCCAGTCATG
PDS7308 TIP41_Like FspBI − 500 bp AACTAAACCAAAGCAAATACGA