Skip to main content

Table 1 Candidate reference genes and primer sequences

From: Selection and validation of reference genes for RT-qPCR analysis in potato under abiotic stress

Gene Gene code Primer sequences (forward/reverse) Amplicon length (bp) log2(drought/CK) Tm (°C) E (%) R2
EF1α PGSC0003DMG400023270 GATGGTCAGACCCGTGAACA 106 0.148 60.9 102.95 0.999
CUL3A PGSC0003DMG400001321 AGCATCGGGTTGTTGTGGAT 170 0.173 59.0 95.56 0.998
GAPDH PGSC0003DMG400015253 GCTCATTTGAAGGGTGGTGC 151 0.257 58.8 101.69 0.997
sec3 PGSC0003DMG402015451 GCTTGCACACGCCATATCAAT 160 0.084 58.0 100.88 0.995
tubulin PGSC0003DMG400009938 GGGAATAACTGGGCGAAAGGT 134 − 0.185 60.0 97.00 0.996
L8 PGSC0003DMG400025015 GTTGGTAATGTGTTGCCGCT 172 0.328 58.8 102.96 0.996
APRT PGSC0003DMG400021527 CGTATCGCTGGGATTGCTTC 177 0.065 58.9 98.31 0.995
actin PGSC0003DMG400023429 AGGAGCATCCTGTCCTCCTAA 180 − 0.315 60.0 103.40 0.998
  1. log 2 (drought/CK) the log2 value of the ratio of drought treatment to control reads per kilo bases per million reads, E PCR efficiency, Tm annealing temperature, R 2 regression coefficient