Skip to main content

Table 2 Primers used in the amplification and sequencing of the DNA fragments

From: Improved method for genomic DNA extraction for Opuntia Mill. (Cactaceae)

Locus/segment Name Sequence 5′–3′ Tm (°C)
ITS ITS5 GGAAGTAAAAGTCGTAACAAGG 57
ITS4 TCCTCCGCTTATTGATATGC 57
rbcL 1f ATGTCACCACAAACAGAAAC 56
724r TCGCATGTACCTGCAGTAGC 56
cox3 Cox3f CCGTAGGAGGTGTGATGT 51
Cox3r CTCCCCACCAATAGATAGAG 51