Skip to main content

Table 1 The gene name, accession number, gene description, primer sequences and amplicon size (bp)

From: Reference genes for normalization of qPCR assays in sugarcane plants under water deficit

Gene Accession no. Gene description Primer Sequence (5′–3′) Size (bp) References
ACT CA148161 Actin F: CTCAACCCCAAGGCTAACAG
R: GGCATGAGGAAGGGCATAA
195 [30]
GAPDH CA254672 Glyceraldehyde-3phosphate dehydrogenase F: TTGGTTTCCACTGACTTCGTT
R: CTGTAGCCCCACTCGTTGT
122 [30]
TUB CA222437 Tubulin F: CTCCACATTCATCGGCAACTC
R: TCCTCCTCTTCTTCCTCCTCG
237 [30]
UBQ1 CA094944 Ubiquitin1 F: AGCCTCAGACCAGATTCCAA
R: AATCGCTGTCGAACTACTTGC
110 *
UBQ2 CA093560 Ubiquitin2 F: CTTCTTCTGTCCCTCCGATG
R: TCCAACCAAACTGCTGCTC
158 *
RPL CA127053 60S ribosomal protein L35-4 F: CTGAAGACGGAGAGGGAAAA
R: GGCGAAGAGAAACTAACAC
264 [31]
25SrRNA1 CO373883
CA171131
25S ribosomal RNA F: ATAACCGCATCAGGTCTCCAAG
R: CCTCAGAGCCAATCCTTTTCC
110 [30]
25SrRNA2 BQ536525 25S ribosomal RNA F: GCAGCCAAGCGTTCATAGC
R: CCTATTGGTGGGTGAACAATCC
108 [30]
  1. * Gene sequence were retrieved from SUCEST database