Skip to main content

Table 2 List of sequencing primers and ISH probes used in this study

From: In situ hybridization for the detection of rust fungi in paraffin embedded plant tissue sections

Primer/probe Sequence
Primer 1 Puccinia 18S Forward (30 bp) 5′ CAATTGGAGGGCAAGTCTGGTGCCAGCAGC 3′
Primer 2 Puccinia 18S Reverse (30 bp) 5′ TGGACCTGGTGAGTTTCCCCGTGTTGAGTC 3′
Puccinia horiana 18S Anti-Sense 5′/biotin/AAGTTCACCAAGAGGTAAGCCTCCAACAA ATCAGTACACACCAAAAGGCAGACCAACTGC 3′
Puccinia horiana 18S Sense 5′/biotin/GCAGTTGGTCTGCCTTTTGGTGTGTACT GATTTGTTGGAGGCTTACCTCTTGGTGAACTT 3′
Uromyces transversalis 18S Anti-Sense 5′/biotin/AAGTTCACCAAGAGGTAAGCCTCCAACA AATCAGTACACACCAAAAGGCGGACCAACTGC 3′
Uromyces transversalis 18S Sense 5′/biotin/GCAGTTGGTCCGCCTTTTGGTGTGTACT GATTTGTTGGAGGCTTACCTCTTGGTGAACTT 3′
Phakopsora pachyrhizi 18S Anti-Sense 5′/biotin/AGGTTCACCAAGAGGTAAGCCTCCAAC AAATCAGTACACACCAAATGGCGGACCAACTGC 3′
Phakopsora pachyrhizi 18S Sense 5′/biotin/GCAGTTGGTCCGCCATTTGGTGTGTACT GATTTGTTGGAGGCTTACCTCTTGGTGAACCT 3′