Skip to main content

Advertisement

Table 2 Details of oligonucleotide primers (gateway compatible) used in this study (5′–>3′)

From: Protocol: a method to study the direct reprogramming of lateral root primordia to fertile shoots

Primer name Forward primer Reverse primer
ARF10 promoter ggggacaactttgtatagaaaagttgttgtcacgattagaatgcacatgcagttcgt ggggactgcttttttgtacaaacttgtctagacgaagttgtgtaacccccaaattct
ARF10 gene ggggacaagtttgtacaaaaaagcaggctgtatggagcaagagaaaagcttggatccacaac Ggggaccactttgtacaagaaagctgggttagcgaagatgctgagcggaccagtcttcgtag
STM gene ggggacaagtttgtacaaaaaagcaggctgtatggagagtggttccaacagcacttcttgtc Ggggaccactttgtacaagaaagctgggttaagcatggtggaggagatgtgatccattgg