Skip to main content

Table 2 List of PCR primers for the HOSUT transgene construct and PCR primers for wheat STS markers on chromosomes 1A, 4A, 7A and 5D

From: The utility of flow sorting to identify chromosomes carrying a single copy transgene in wheat

Name Target Forward primer sequence Reverse primer sequence Amplicon size (bp) Annealing temperature (°C)
HvSUT_6 HOSUT1 AGCGGCGGCGGTCACTGACTG CCAAAGGACGACACCCCAGCC 265 62
HvSUT_7 HorB1 terminator ATTAATTCCTCCCCGACCCTGC CAATGGAGACGGCGCGTGCAA 471 62
HvSUT_11 HOSUT1 GGCGGAACCCGCCGTGCAG CCTGCGTCTTCCCCATCTGGAAGTA 241 62
HvSUT_RT HOSUT1 CGGGCGGTCGCAGCTCGCGTCTATT CATACAGTGACTCTGACCGGCACACA 169 62
Owm121 Chromosome 4A ATTGCCGTCGCGAACTAGA CGGGACGAGCTTGACGAT 351 60
Owm126 Chromosome 4A CCAGTCAGAAATTATTATGAACCTATC CGCTGTCTCGAGATTGGAGT 342 60
Owm161 Chromosome 4A TTTTCAAGCAGGTTTTGTGC TCACTTCTCTTCTTTGCGTTCA 324 60
Owm167 Chromosome 4A TTTTCTTGGTCAGTATAACCTGTTTTT TGAGCAGAGAAAAATTTCCAAG 285 60
Owm174 Chromosome 1A GCATCCTAGTTTCTCTCTCAAGT AACAAGATCACGAGCGAATTG 157 58
Owm175 Chromosome 1A AAACCCCTGATACTCATGCG GTTTCTTGTCATTCATGTCACTTGT 530 58
Owm176 Chromosome 1A TTCCTGTCTGACTCCGCG AACCACAACCGTCAACCG 104 58
Owm177 Chromosome 1A GTAGTCTGCTCCCGAGGAAT GTCTCTAACCATACATCCATGAAGT 192 58
Owm178 Chromosome 1A CAACTTCTTCACATCCCGGAA ATTTGGCCCTATGAGATATAATTACG 306 58
Owm179 Chromosome 1A ACACTGTGATACCTCTAGATGTATG CACATTGCCTATAAATTCTAAAAGGTC 425 58
Owm180 Chromosome 5D CGGACGAGCAGCAGTACC GCAGATCGGCATAAATTGAATGT 292 58
Owm181 Chromosome 5D GGAGGTGTTCTAGGTGTACTTACT AGAGCAATGTCAGAAGTCATCG 240 58
Owm182 Chromosome 5D TCTCCACCTGCAGAGTCG CATCAGGCCACAGTGTCAAT 119 58
Owm183 Chromosome 5D TGTCCACACATTTCCCGTATG AGTGGTGGATGTGGTTGCT 196 58
Owm184 Chromosome 5D AGCATGCTCCCAAAGACTATTAC GTTATGATGGTGGTAGCAATTTGA 400 58
Owm185 Chromosome 5D GTGAACCTATATGACATCTTACCGG GGGGCAGTTGTCAAGTATTGC 421 58
Owm186 Chromosome 7A CTCTCTGTGGCCAATAGTGC TCTATACCTCAACCCTACATCCA 112 58
Owm187 Chromosome 7A GGCCACGAATTCCACAAGTA CTATCGATCAACCAACCATCCA 229 58
Owm188 Chromosome 7A GTACGAGTGCAGACAGTGTG ACAATTAATTATACGCCCAGTTAAGC 282 58
Owm189 Chromosome 7A CGTGCTTTCTTCTTCCTCCG GCAGGTTAGTTTCTTGTGGTTG 185 58
Owm190 Chromosome 7A CGCATGGACATTGTTCTAGTCA GCACTTAGGCACGCTTGAG 517 58
Owm191 Chromosome 7A CGACGACATTAGGAATATGGGAT TGCGTGTGGGTGTGCTTA 402 58