Skip to main content

Table 1 smFISH probe sequences used to detect PP2A mRNA

From: A method for detecting single mRNA molecules in Arabidopsis thaliana

PP2A exon probes Sequences (5′–3′)
1 ccgagcgatctatcaatcag
2 gacatcctcaccaaaactca
3 tcgggtataaaggctcatca
4 tagctcgtcgataagcacag
5 ccaagagcacgagcaatgat
6 atcaactcttttcttgtcct
7 catcgtcattgttctcacta
8 atagccaaaagcacctcatc
9 atacagaataaaacccccca
10 caagtttcctcaacagtgga
11 tcatctgagcaccaattcta
12 tagccagaggagtgaaatgc
13 cattcaccagctgaaagtcg
14 ggaaaatcccacatgctgat
15 atattgatcttagctccgtc
16 attggcatgtcatcttgaca
17 aaattagttgctgcagctct
18 gctgattcaattgtagcagc
19 ccgaatcttgatcatcttgc
20 caaccctcaacagccaataa
21 ctccaacaatttcccaagag
22 caaccatataacgcacacgc
23 agtagacgagcatatgcagg
24 gaacttctgcctcattatca
25 cacagggaagaatgtgctgg
26 tgacgtgctgagaagagtct
27 cccattataactgatgccaa
28 tggttcacttggtcaagttt
29 tctacaatggctggcagtaa
30 cgattatagccagacgtact
31 gactggccaacaagggaata
32 catcaaagaagcctacacct
33 ttgcatgcaaagagcaccaa
34 acggattgagtgaaccttgt
35 cttcagattgtttgcagcag
36 ggaccaaactcttcagcaag
37 ggaactatatgctgcattgc
38 gtgggttgttaatcatctct
39 tgcacgaagaatcgtcatcc
40 ttactggagcgagaagcga
41 ctctgtctttagatgcagtt
42 gaacatgtgatctcggatcc
43 catcattttggccacgttaa
44 cgtatcatgttctccacaac
45 atcaacatctgggtcttcac
46 ttggagagcttgatttgcga
47 acacaattcgttgctgtctt
48 cgcccaacgaacaaatcaca