Skip to main content

Table 3 Profiling primer sequences and annealing temperatures

From: Novel applications of motif-directed profiling to identify disease resistance genes in plants

Primer name Primer sequence Ta Reference
Pk1Fa GGyTTTGGwrinGTyTACAAAGG 52 [42]/this study
PK1Fb GGyTTTGGwrinGTyTAtAAGGG 52 [42]/this study
PK4R1a yykrGCyAGyCCAAAATC 54 [42]/this study
PK3Fb rTyGTrCATAGrGACATCAA 54 [42]/this study
NBS1 GCiArwGTwGTyTTiCCyrAiCC 55 [49]
NBS2 GTwGTyTTiCCyrAiCCissCAT 60 [24]
NBS5a6 yyTkrThGTmiTkGATGAyrTiTGG 55 [49]
NBS9 TGTGGAGGrTTACCTCTAGC 55 [24]
chcR1 TGGmCkrAGAAAmCCTTCwGCCATC 66 This study
chcR2 CCwArrCCwsCCATwCCyACTAT 62 This study
chcF2 CTACCAmkyCGAsArAcAGATTCC 64 This study
NBS13R AAGAArCATGCdATATCTArAAATAT 55 [30]
NBS15F ATGCATGAyTTrATwvAAGAbATGGG 55 [30]
TIR300Fc TAGTrAAGATyATGGAATGCA 55 This study
TIR300F nTAGTrAAGAyATGGAATGC 55 [30]
TIR9256 ATGGCATCTTCTTCTTCTTCTTTTGCG 55 [30]
TIR3R CTTCACTAnTTCATyCAAGCACC 55 [30]
TIRWCF AGAATTAyrCiACrTCiAGrTGGTG 60 This study
Adapt-upper ACTCGATTCTCAACCCGAAAGTATAGATCCCA   [24]
Adapt-lower blunt TGGGATCTATACTT-NH2   This study
TG233F CATGCCTTTTTCTTGGGATG   This study
TG233R TGGAACCCCTTTAACTGTGC   This study
198E12T-F GACTCTGCCGTGATTGCTGAA   This study
198E12T-R CACCGGGAAGACGCTGTTT   This study
Aseq primer GCCTCCCTCGCGCCATCAG   Roche
Bseq primer GCCTTGCCAGCCCGCTCAG   Roche
454Adpt Primer GCCTCCCTCGCGCCATCAGGTTTACTCGATTCTCAACCCGAAAG   This study
454B01-NBS5a GCCTTGCCAGCCCGCTCAGACGAGTGCGT yyTkrThGTmiTkGATGAYGTiTGG   This study
454B02-NBS5a GCCTTGCCAGCCCGCTCAGACGCTCGACA yyTkrThGTmiTkGATGAYGTiTGG   This study
454B03-NBS5a GCCTTGCCAGCCCGCTCAGAGACGCACTC yyTkrThGTmiTkGATGAYGTiTGG   This study
454B04-NBS5a GCCTTGCCAGCCCGCTCAGAGCACTGTAG yyTkrThGTmiTkGATGAYGTiTGG   This study
454B05-NBS5a GCCTTGCCAGCCCGCTCAGATCAGACACG yyTkrThGTmiTkGATGAYGTiTGG   This study
454B06-NBS5a GCCTTGCCAGCCCGCTCAGATATCGCGAG yyTkrThGTmiTkGATGAYGTiTGG   This study
454B07-NBS5a GCCTTGCCAGCCCGCTCAGCGTGTCTCTA yyTkrThGTmiTkGATGAYGTiTGG   This study
454B08-NBS5a GCCTTGCCAGCCCGCTCAGCTCGCGTGTC yyTkrThGTmiTkGATGAYGTiTGG   This study
454B09-NBS5a GCCTTGCCAGCCCGCTCAGTAGTATCAGC yyTkrThGTmiTkGATGAYGTiTGG   This study
454B10-NBS5a GCCTTGCCAGCCCGCTCAGTCTCTATGCG yyTkrThGTmiTkGATGAYGTiTGG   This study
454B11-NBS5a GCCTTGCCAGCCCGCTCAGTGATACGTCT yyTkrThGTmiTkGATGAYGTiTGG   This study
454B12-NBS5a GCCTTGCCAGCCCGCTCAGTACTGAGCTA yyTkrThGTmiTkGATGAYGTiTGG   This study
  1. Ta: annealing temperature.