Skip to main content

Table 1 Primer sequences used for QPCR analysis

From: Protocol: Chromatin immunoprecipitation (ChIP) methodology to investigate histone modifications in two model diatom species

Primer name Sequence
Tp H4 Promoter fw AGCCTGATGGAGAGAGTGGA
Tp H4 Promoter rev TACATCCAGGACCTCCGTTC
Tp H4 body fw TCGTAGAAAACGGTCCCATC
Tp H4 body rev CCTCCACTTGGAAGAAGCAG
Tp Phyto promoter fw CGATGTTGGTTGAGTGTTGG
Tp Phyto promoter rev GCGATGTGCTCTTTTTGACA
Tp Phyto body fwd TTTGGATTCCGTGAGAAAGG
Tp Phyto body rev GTCTCGTGCACTCATCTCCA
Tp EU432485 fw CCAGAGCTCGACAAACATGA
Tp EU432485 rev TCGTTTTCCCTACGTGGAAC
Tp EU432490 fw AGGAACTCGGAGACAAAGCA
Tp EU432490 rev ATGTGCCCTCTTCAACAACC
Tp EU432492 fw GCTCTGTCGTCGGAAAACTC
Tp EU432492 rev AGGACAGCCTGCGTAGAAAA
Tp EU432500 fw TGATGCAACAGGACGAAGAG
Tp EU432500 rev GCATTGTTGGCCTTGTACCT
Pt H4 promoter fw GTTGGTCGTCCATCGTTAGC
Pt H4 promoter rev CCGTGGACGTTCTTGGTAGT
Pt H4 body fw AATTACCAAGCCCGCTATCC
Pt H4 body rev GTTTCTGTGAAACGGCAGGT
Pt PHY promoter fw CTTGCCATGTCTTTGCAGTG
Pt PHY promoter rev GTCAACACGCAATCAAGCAC
Pt PHY body1 fw CAGCGACGGAAATGGACTAC
Pt PHY body1 rev TTAGCAAGCAAGTGCGTCAG
Pt BKB4022 fw CGAAGCTACTATGCCGGAAG
Pt BKB4022 rev AAGGACACGAGAGTCGAGGA
PTC30 fw CGGACTTCACCGAAGACAAT
PTC30 rev GAATGGCTTTGGCATCATCT
PTC66 fw AGCGATGGAACATTGGTTTATC
PTC66 rev AACGTATCGTGAGCCTGACC
PTC25 fw GCCTACCCCATGAAAACTGA
PTC25 rev AGGCTCACTCTGCCACTGAT
SCF Fw CAGCCTGAGGCGAAAGATAC
SCF rev TAGTTCTGACATGCGCCAAG