Skip to main content

Table 1 Sequences of adapters and primers

From: Universal Multiplex PCR: a novel method of simultaneous amplification of multiple DNA fragments

Name Sequence (5' to 3') Tm (°C) References
universal adapter-F CTCGTAGACTGCGTACCA 57.30 This study
universal adapter-R TACTCAGGACTCATCGTC 55.02 This study
common adapter CCTTCCTTCCTTCCCCCC 61.86 Bai et al., 2009
phi085-F AGCAGAACGGCAAGGGCTACT 61.92 MaizeGDB
phi085-R TTTGGCACACCACGACGA 57.30 MaizeGDB
U-phi085-F CTCGTAGACTGCGTACCA AGCAGAACGGCAAGGGCTACT 72.61 This study
U-phi085-R TACTCAGGACTCATCGTC TTTGGCACACCACGACGA 70.05 This study
C-phi085-F CCTTCCTTCCTTCCCCCC AGCAGAACGGCAAGGGCTACT 74.71 This study
C-phi085-R CCTTCCTTCCTTCCCCCC TTTGGCACACCACGACGA 73.47 This study
phi041-F TTGGCTCCCAGCGCCGCAAA 63.95 MaizeGDB
phi041-R GATCCAGAGCGATTTGACGGCA 61.94 MaizeGDB
U-phi041-F CTCGTAGACTGCGTACCA TTGGCTCCCAGCGCCGCAAA 73.96 This study
U-phi041-R TACTCAGGACTCATCGTC GATCCAGAGCGATTTGACGGCA 71.33 This study
C-phi041-F CCTTCCTTCCTTCCCCCC TTGGCTCCCAGCGCCGCAAA 76.12 This study
C-phi041-R CCTTCCTTCCTTCCCCCC GATCCAGAGCGATTTGACGGCA 74.40 This study
phi123-F GGAGACGAGGTGCTACTTCTTCAA 61.97 MaizeGDB
phi123-R TGTGGCTGAGGCTAGGAATCTC 61.94 MaizeGDB
U-phi123-F CTCGTAGACTGCGTACCA GGAGACGAGGTGCTACTTCTTCAA 71.87 This study
U-phi123-R TACTCAGGACTCATCGTC TGTGGCTGAGGCTAGGAATCTC 71.33 This study
C-phi123-F CCTTCCTTCCTTCCCCCC GGAGACGAGGTGCTACTTCTTCAA 73.82 This study
C-phi123-R CCTTCCTTCCTTCCCCCC TGTGGCTGAGGCTAGGAATCTC 74.40 This study
umc1478-F GAAGCTTCTCCTCTCGCGTCTC 63.80 MaizeGDB
umc1478-R CAGTCCCAGACCCTAGCTCAGTC 65.52 MaizeGDB
U-umc1478-F CTCGTAGACTGCGTACCA GAAGCTTCTCCTCTCGCGTCTC 73.38 This study
U-umc1478-R TACTCAGGACTCATCGTC CAGTCCCAGACCCTAGCTCAGTC 73.10 This study
C-umc1478-F CCTTCCTTCCTTCCCCCC GAAGCTTCTCCTCTCGCGTCTC 75.43 This study
C-umc1478-R CCTTCCTTCCTTCCCCCC CAGTCCCAGACCCTAGCTCAGTC 76.10 This study
umc1268-F ACGAACAACCTAGCACAGTCCTAAA 60.34 MaizeGDB
umc1268-R CAAGGCGGTTACCAAGTTTACATC 60.26 MaizeGDB
U-umc1268-F CTCGTAGACTGCGTACCA ACGAACAACCTAGCACAGTCCTAAA 70.70 This study
U-umc1268-R TACTCAGGACTCATCGTC CAAGGCGGTTACCAAGTTTACATC 69.92 This study
C-umc1268-F CCTTCCTTCCTTCCCCCC ACGAACAACCTAGCACAGTCCTAAA 71.93 This study
C-umc1268-R CCTTCCTTCCTTCCCCCC CAAGGCGGTTACCAAGTTTACATC 72.85 This study
phi120-F TGATGTCCCAGCTCTGAACTGAC 61.92 MaizeGDB
phi120-R GACTCTCACGGCGAGGTATGA 61.95 MaizeGDB
U-phi120-F CTCGTAGACTGCGTACCA TGATGTCCCAGCTCTGAACTGAC 72.10 This study
U-phi120-R TACTCAGGACTCATCGTC GACTCTCACGGCGAGGTATGA 71.56 This study
  1. Tms are taken from the primer synthesis report card.