Skip to main content

Table 2 Details of primers used for gene isolation and HRM analysis.

From: High Resolution Melt (HRM) analysis is an efficient tool to genotype EMS mutants in complex crop genomes

Primera Geneb Stagec Mutation Targetedd Sequence 5' to 3'e
BrCAX1 TILLING_Forward BraA.CAX1.a TILLING   AGAGATTTCCTAGCCATGTG
BrCAX1 TILLING_Reverse BraA.CAX1.a TILLING   CGACCCCTAATTGTTTTATGTG
BrCAX1 HRM1_Forward BraA.CAX1.a HRM 6,16 TCCTCGAAGTTGCCTCTGAT
BrCAX1 HRM1_Reverse BraA.CAX1.a HRM 6,16 GCTGCTGACCATTGTTCCTG
BrCAX1 HRM3_Forward BraA.CAX1.a HRM 7,8,12,14,20 GCAGGAACAATGGTCAGCAG
BrCAX1 HRM3_Reverse BraA.CAX1.a HRM 7,8,12,14,20 CGAGAATGACTTCTTGGAGATT
BrCAX1 HRM6_Forward BraA.CAX1.a HRM 4,10,11,18 TCCAGAAGGTTCCATACAAAGG
BrCAX1 HRM6_Reverse BraA.CAX1.a HRM 4,10,11,18 CGCTGTTCTGTTTAGTAATGTGTTG
BrMet1aF4 BraA.MET1.a Gene isolation   ACTTCACAGCATCTCCTCAGGGC
BrMet1aF5 BraA.MET1.a Gene isolation   CTTGACAATGGTGCTGTTATTCAG
BrMet1aF6 BraA.MET1.a Gene isolation   GTCTGGTTTGATGGCAGAGGACG
BrMet1aR4 BraA.MET1.a Gene isolation   CGCACTTCGCAGCTTCAGAAAC
BrMet1aR5 BraA.MET1.a Gene isolation   AAATAGAGATTGTTGAACACCCCC
BrMet1aR6 BraA.MET1.a Gene isolation   TTGGATACCACAGGTGCCATGC
BrMet1aHRMF BraA.MET1.a HRM 3,6,7,10,14 TGCGATGATAAGGAGAAAGG
BrMet1aHRMR BraA.MET1.a HRM 3,6,7,10,14 TTTGCCGTCTCATCCAAAC
  1. a- Primer name, b-gene primer designed to, c-stage of analysis primer used, d-line primers used to genotype, e- sequence of primer