Skip to main content

Table 1 Primers used in this study.

From: Protocol: methodology for chromatin immunoprecipitation (ChIP) in Chlamydomonas reinhardtii

Nr. Target Primer sequences (5' to 3') Amplicon size (bp)
1 HSP70A promoter
(endpoint PCR)
For: GACGGTGGGGAGCTCGCTGAGGC
Rev: GGTGCCCAGGTCAATACCGATAGC
327
2 RBCS2 promoter
(endpoint PCR)
For: GCCAGAAGGAGCGCAGCCAAACCA
Rev: ACGGAGGACTTGGCAATGACGG
237
3 HSP70A promoter
(qPCR)
For: CGGTATAAAAGCCCGCGAC
Rev: GTGCCCAGGTCAATACCGATAG
163
4 RBCS2 promoter
(qPCR)
For: CAATGCAAGCAGTTCGCATG
Rev: ACGGAGGACTTGGCAATGAC
138
5 CYC6 promoter
(qPCR)
For: ACACGCCCCTCATTCACAGA
Rev: GCACACGAGACACTCCGAGC
121