Skip to main content

Table 1 Sequences of primers used for RT-PCR and qRT-PCR.

From: An effective virus-based gene silencing method for functional genomics studies in common bean

Primer name Primer sequence (5→3, forward, reverse) Protein name
nod22 forw ATGTTCCACAGTAGCAAAAACA Nodulin 22
nod22 rev TCACTGTACAAGCACAAGTCTC Nodulin 22
nod22-ext. GTCTTCGCCCGAAAAAGAAAGG GCAGAGGATTGCAACACCAAGA Nodulin 22
nod22-int. GAGACTGAGGGTATCGGCGACGTG GATTCTGGTAAACGGAACCTCCAC Nodulin 22
PvSACPD-C' TATGTACGACGGGGAAGACC GATTGGAGAAGCTGGAAGGT Stearoyl-ACP
desaturase (C-like)
PvEf1-α GGTCATTGGTCATGTCGACTCTGG GCACCCAGGCATACTTGAATGACC Elongation factor-1 alpha