Figure 2From: NEATTILL: A simplified procedure for nucleic acid extraction from arrayed tissue for TILLING and other high-throughput reverse genetic applicationsGenomic DNA quality and PCR amplification of DNA isolated using different modifications A- Gel electrophoresis of DNA Lane. 1: Tissue was homogenized in extraction buffer (0.1 M Tris-HCl, pH 7.5; 0.05 M EDTA, pH 8.0; 1.25% (w/v) SDS), Lane 2: Same as lane 1 with additional step of PCI (25:24:1). The DNA pellet after dissolving in 200 μl of milliQ water was extracted with an equal volume of PCI. The aqueous phase was collected and DNA was reprecipitated and dissolved in milliQ water, Lane 3: Same as lane 1 with inclusion of 2% (w/v) PVP and 0.2 M β-ME during extraction and PCI extraction was done as for lane 2, Lane 4: Same as in lane 3 but without PCI step, Lane 5: Same as in lane 3 but without β-ME, Lane 6: Same as lane 1 with inclusion of 2% (w/v) PVP during extraction, Lane 7: Same as lane 1 with inclusion of 30 mg PVPP and 0.2 M β-ME during extraction and PCI extraction as done for lane 2, Lane 8: Same as lane 1 with inclusion of 30 mg PVPP and 0.2 M β-ME during extraction, Lane 9: Same as lane 1 with inclusion of 30 mg PVPP during extraction, Lane 10: DNA isolated by Qiagen kit. Abbreviations: PCI-phenol:chloroform:isoamyl alcohol, β-ME-β-mercaptoehanol, PVP-Polyvinylpyrrolidone, PVPP-Polyvinylpolypyrrolidone. B- PCR amplification of isolated DNA. The quality of DNA was checked by PCR amplification of actin gene using forward primer 5'TAACCCAAAAGCCAATCGAG3' and reverse primer 5'AGCTTCCATTCCGATCATTG3'.Back to article page