Skip to main content

Advertisement

Table 2 PCR primer sequences and tags used for the amplification and sequencing of the BrWD40 genomic region.

From: Targeted identification of genomic regions using TAGdb

Primer pair Primer sequence (5'-3') Tag name Primer position relative to AtWD40 start codon (bp) B. rapa product size (bp)
1F TCGGACAAGGAGACGGGTCC BrC_27_001_56-123-1844_2 290 a: 2862
1R AAGAGCTGGTACACAGGTAACG BrC_27_001_56-123-1844_1 3224  
2F CAAAAATAACTCACATTGACATCAA BrC_37_001_40-284-1268_1 (no match) b: 2945
2R TCAGAACAGGAAGGTCAATTTC BrC_37_001_40-284-1268_2 2070  
Sequencing primers
3F GGTGCTGGATTCATGCTTTAC BrC_03_002_4-32-317-1572-1 1123  
3R CTGATTGCAGGAGGACACAA BrC_03_002_4-32-317-1572-2 (no match)  
4F GGGCATGCCATCTGTTATATG BrC_03_001_3-13-638-284-2 (no match)