Figure 4

'Site-directed mutagenesis' and 'short sequence insertion' protocols. (A) Schematic 'site-directed mutagenesis' protocol. PCR amplification of the two terminal regions for creation of overlapping ends with specific primers that harbor mutated nucleotide(s). Overlap extension assembly of the PCR fragments then LR clonase cloning of the mutant fragment produces a binary expression vector. (B) Schematic 'short sequence insertion' protocol. PCR amplifications of two regions flanking the tag insertion position with specific PCR primers tailed with tag sequence. Overlap extension assembly of the PCR fragments with overlapped tag sequence ends, direct LR clonase cloning and generation of binary expression vector. (C) Sequence analysis of AtCesA4^Cys>SercDNA mutant in which the codon of Cys¹⁰⁴⁹ residue was converted to Ser (GVDC¹⁰⁴⁹ > GVDS) using the 'site-directed mutagenesis' protocol. The mutated AtCesA4^Cys>SercDNA is directly cloned into p3KC binary destination vector. The specific forward PCR primer (SF-ggcgtcgactcttaaatgagg), mutated Ser residue and Cys nucleotide from the wt cDNA clone replaced in the mutant are designated on the chromatogram. (D) Sequence analysis of AtCesA7 cDNA with in frame inserted StrepII tag sequence (aa: WSHPQFEK) in the middle of the spacer region between transmembrane domains 5 and 6. The specific primers tailed with StrepII sequence used for this were SF- gtctcatcctcaatttgaaaaagatgatgatgactttggag and SF- ttcaaattgaggatgagaccatgttgcctttgatgtgacg. Overlap extension assembled StrepII sequence- tailed PCR fragments are directly LR clonase cloned into p3KC binary destination vector. The inserted StrepII sequence, place of the insertion in AtCesA7 cDNA and the region of overlapping primers are designated on the chromatogram.