Skip to main content
Figure 3 | Plant Methods

Figure 3

From: A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps

Figure 3

DNA 'domain swap' protocol. (A) Schematic of 'domain swap' protocol. PCR amplification from the domain acceptor entry clone (primer pairs F × SR1 and SF2 × R) of the two terminal regions flanking the DNA domain to be replaced. PCR amplification (primer pair SF1 × SR2) of the donor domain to be inserted. Overlap extension assembly of the three PCR fragments with short overlapping ends (for details see Fig. 1). Direct LR clonase cloning of the assembled fragment produces the binary expression clone. Note that SF1/SR1 and SF2/SR2 are complementary primer pairs consisting of the edges of both domain acceptor and donor. (B) Sequencing of the two DNA fusion sites of expression vector p3K235 that contained AtCesA7 (aa: 1-36)/AtCesA4 (aa: 23-72)/AtCesA7 (aa: 87-1026) domain swap variant in the p3KC binary destination vector. Cloning features: domain acceptor entry clone - pZ3 (AtCesA7); domain donor - plasmid cDNA clone U50150- RIKEN; primer SF1-ctagatggacaattctgcaaagtctgtggc; primer SF2- tgcaacactctttacaagcgtctcagagga; The two fusion sites at the ends of the domain swapped region are designated on the chromatograms.

Back to article page

Plant Methods

ISSN: 1746-4811